PMID- 11884248 TI - Reporting of measures of accuracy in systematic reviews of diagnostic literature AB - Abstract | Background | There are a variety of ways in which accuracy of clinical tests can be summarised in systematic reviews. Variation in reporting of summary measures has only been assessed in a small survey restricted to meta-analyses of screening studies found in a single database. Therefore, we performed this study to assess the measures of accuracy used for reporting results of primary studies as well as their meta-analysis in systematic reviews of test accuracy studies. Methods | Relevant reviews on test accuracy were selected from the Database of Abstracts of Reviews of Effectiveness (1994 --2000), which electronically searches seven bibliographic databases and manually searches key resources. The structured abstracts of these reviews were screened and information on accuracy measures was extracted from the full texts of 90 relevant reviews, 60 of which used meta-analysis. Results | Sensitivity or specificity was used for reporting the results of primary studies in 65/90 (72%) reviews, predictive values in 26/90 (28%), and likelihood ratios in 20/90 (22%). For meta-analysis, pooled sensitivity or specificity was used in 35/60 (58%) reviews, pooled predictive values in 11/60 (18%), pooled likelihood ratios in 13/60 (22%), and pooled diagnostic odds ratio in 5/60 (8%). Summary ROC was used in 44/60 (73%) of the meta-analyses. There were no significant differences in measures of test accuracy among reviews published earlier (1994 --97) and those published later (1998 --2000). Conclusions | There is considerable variation in ways of reporting and summarising results of test accuracy studies in systematic reviews. There is a need for consensus about the best ways of reporting results of test accuracy studies in reviews. Keywords: Background : The manner in which accuracy of clinical tests is mathematically summarised in the biomedical literature has important implications for clinicians. Appropriate accuracy measures would be expected to sensibly convey the meaning of the study results with scientifically robust statistics without exaggerating or underestimating the clinical significance of the findings. Lack of use of appropriate measures may lead authors of primary accuracy studies to draw biased conclusions. In systematic reviews of test accuracy literature, there are many ways of synthesising results from several studies, not all of which are considered to be scientifically robust. For example, measures such as sensitivity and specificity commonly used in primary studies are not considered suitable for pooling separately in meta-analysis. Variations in reporting of summary accuracy and use of inappropriate summary statistics may increase the risk of misinterpretation of clinical value of tests. A recent study evaluated a small sample of meta-analytical reviews of screening tests to demonstrate the variety of approaches used to quantitatively summarise accuracy results. This study confined itself to a limited Medline search. It exclusively examined meta-analytical studies so reviews not using quantitative synthesis were excluded. It did not look at accuracy measures used to report results of primary studies separately from those used for meta-analyses. In order to address these issues, we undertook a comprehensive search to survey systematic reviews (with and without meta-analysis) of test accuracy literature to assess the measures used for reporting results of included primary studies as well as their quantitative synthesis. Methods : We manually searched for relevant reviews in the Database of Abstracts of Reviews of Effectiveness (DARE). In order to limit the impact of human error inherent in manual searching, we complemented it with electronic searching. DARE was searched electronically with word variants of relevant terms (diagnostic, screening, test, likelihood ratio, sensitivity, specificity, positive and negative predictive value) combined using OR. From 1994 to 2000 DARE has identified 1897 reviews of different types by regular electronic searching of several bibliographic databases, hand searching of key major medical journals, and by scanning grey literature (search strategy and selection criteria can be found at ). The structured abstracts of these reviews were screened independently by the authors to identity systematic reviews of test accuracy. The full texts were obtained of those abstracts judged to be potentially relevant. Reviews addressing test development and diagnostic effectiveness or cost effectiveness were excluded. Any disagreements about review selection were resolved by consensus. Information from each of the selected reviews was extracted for the measures of test accuracy used to report the results of the primary studies included in the review. If a meta-analysis was conducted, information was also extracted for the summary accuracy measures. The various accuracy measures are shown in Table . We sought the following in the primary studies: sensitivity or specificity, predictive values, likelihood ratios and diagnostic odds ratio. For meta-analysis, we sought the summary measures pooling the above results and summary receiver operating characteristics (ROC) plot or values. All extracted data were double-checked. We divided the reviews into two groups arbitrarily according to time of publication; one group covering the period 1994 --97 (50 reviews) and another covering 1998 --2000 (40 reviews). This allowed us to assess whether there were any significant differences in measures being used to report test accuracy results among reviews published earlier and those published later. As the approaches to summarising results are not mutually exclusive, we evaluated and reported the most commonly used measures and their most common combinations. We used chi-squared statistical test for comparison of differences between proportions. Table 1 | Measures of accuracy of dichotomous test results Results : Of the abstracts available in DARE, 150 were considered to be potentially relevant. Excluding reviews that addressed test development and diagnostic effectiveness or cost, 90 reviews of test accuracy were left for inclusion in our survey. There were 45 reviews of dichotomous test results, 42 reviews of continuous results dichotomised by the original authors, and 3 reviews that contained both result types. Meta-analysis was used in 60/90 (67 %) reviews, 50 in 1994 --97 and 40 in 1998 --2000. (See : BMC_IncludedRefList_04032002 for a complete listing of the 90 reviews included in our study). As shown in Table , sensitivity or specificity was used for reporting the results of primary studies in 65/90 (72%) reviews, predictive values in 26/90 (28%), and likelihood ratios in 20/90 (22%). For meta-analysis, independently pooled sensitivity or specificity was used in 35/60 (58%) reviews, pooled predictive values in 11/60 (18%), pooled likelihood ratios in 13/60 (22%), and pooled diagnostic odds ratio in 5/60 (8%). Summary ROC was used in 44/60 (73%) of the meta-analyses. There were no significant differences between reviews published earlier and those published later as shown in Table . Table 2 | Measures of test accuracy reported in review of diagnostic literature (1994 --2000) Discussion : Our study showed that sensitivity and specificity remain in frequent use, both for primary studies and for meta-analyses over the time period surveyed. Sensitivity and specificity are considered inappropriate for meta-analyses, as they do not behave independently when they are pooled from various primary studies to generate separate averages. In our survey, separate pooling of sensitivities or specificity was used frequently in meta-analyses where summary ROC would have been more appropriate. . Our findings about reporting of summary accuracy measures in meta-analyses are different to those reported previously. We found a higher rate of use of summary ROC, though use of independent summaries of sensitivity, specificity and predictive values were similar. These differences may be due to differences in searching strategies (databases and time frames) and selection criteria. Our search was more recent and comprehensive, using DARE, which has covered seven different databases (Medline, CINAHL, BIOSIS, Allied and Alternative Medicine, ERIC, Current Contents clinical medicine and PsycLIT), and hand-searched 68 peer-reviewed journals and publications from 33 health technology assessment centres around the world since February 1994. Moreover, as we did not restrict our selection to meta-analytical reviews only, we were able to examine reviews summarising accuracy results of primary studies without quantitative synthesis, which constituted 33% (30/90) of our sample. Therefore, compared to the previous publication on this topic, our survey provided a broader and more up-to-date overview of the state of reporting of accuracy measure in test accuracy reviews. Conclusions : The use of inappropriate accuracy measures has the potential to bias judgement about the value of tests. Of the various approaches to reporting accuracy of dichotomous test results, likelihood ratios are considered to be more clinically powerful than sensitivities or specificities. Crucially, it has been empirically shown that authors of primary studies may overstate the value of tests in the absence of likelihood ratios. There is also evidence that readers themselves may misinterpret test accuracy measures following publication. It is conceivable that the problem of inconsistent usage of test accuracy measures in published reviews, as found in our survey, may contribute to misinterpretation by clinical readership. The reason for variation in reported accuracy measures may, in part, be attributed to a lack of consensus regarding the best ways to summarise test results. It is worth noting that despite authoritative publications about appropriate summary accuracy measures in the past, (we have only quoted a few references) inconsistent and inappropriate use of summary measures has remained prevalent in the period 1994 --2000. Our paper highlights the need for consensus to support change in this field of research. Competing interest : None declared Backmatter: PMID- 11914161 TI - A randomised controlled trial of a patient based Diabetes recall and Management system: the DREAM trial: A study protocol [ISRCTN32042030] AB - Abstract | Background | Whilst there is broad agreement on what constitutes high quality health care for people with diabetes, there is little consensus on the most efficient way of delivering it. Structured recall systems can improve the quality of care but the systems evaluated to date have been of limited sophistication and the evaluations have been carried out in small numbers of relatively unrepresentative settings. Hartlepool, Easington and Stockton currently operate a computerised diabetes register which has to date produced improvements in the quality of care but performance has now plateaued leaving substantial scope for further improvement. This study will evaluate the effectiveness and efficiency of an area wide 'extended' system incorporating a full structured recall and management system, actively involving patients and including clinical management prompts to primary care clinicians based on locally-adapted evidence based guidelines. Methods | The study design is a two-armed cluster randomised controlled trial of 61 practices incorporating evaluations of the effectiveness of the system, its economic impact and its impact on patient wellbeing and functioning. Keywords: Background : Delivering care to people with diabetes | There is broad, international agreement over what constitutes high quality health care for people with diabetes . This will be enshrined in a National Service Framework for people with diabetes, due in summer 2002. However, in the face of poor current performance the most efficient method of delivering care remains unclear . Following a 1994 systematic literature review suggesting structured care improved patient care, an editorial in the British Medical Journal concluded that more evaluative research was needed before widespread adoption of any of the models could be recommended . A subsequent systematic review of routine surveillance of patients with diabetes by Griffin and Kinmonth concluded "Computerised central recall, with prompting for patients and their family doctors, can achieve standards of care as good or better than hospital outpatient care, at least in the short term. The evidence supports provision of regular prompted recall and review of people with diabetes by willing general practitioners and demonstrates that this can be achieved, if suitable organisation is in place'. However, the evidence base on which these conclusions are based is limited in several ways. Firstly there are only five randomised controlled trials (RCTs) involving 1058 patients. All of these studies are 'patient randomised" trials, thus potentially under-estimating the effectiveness of the intervention (see Study Design). They were all evaluating more or less selected patients and general practices and none of them were explicitly evaluating a UK National Health Service (NHS) service area wide intervention. Only one of the four UK based studies evaluated patient based outcomes and included an economic assessment and this study only involved patients from three general practices . Thus, the effectiveness of an area wide, patient focussed, structured recall and management system (in terms of process of care, patient outcome and economic impact) remains unknown. The current system | The current computerised diabetes management system runs in Hartlepool, Easington and Stockton, three Primary Care Group (PCG) areas, in the Northern and Yorkshire Region. It was introduced to all 36 general practices in Hartlepool and Easington Districts in mid-1995. Stockton (25 practices) agreed to join the system in 1999 and it was operational there by October 2000. There are three key components to the current system: 1. A central register of patients with diabetes. 2. A structured minimum dataset to be completed and returned to the central register. 3. The provision of both patient specific and aggregated data to both patients and clinicians. The system (developed by Westman Medical Software) allows three methods of collection of data at each contact with a patient with diabetes who is registered on the database. Two methods use a standard form completed by clinicians to collect data concordant with the UK minimum data set . Within secondary care, forms are completed at every new patient or annual review. In primary care, forms are completed by the practice nurse (usually) or general practitioner, either opportunistically or at practice diabetic clinics. In both cases, the completed data forms are sent to the Diabetes Register Facilitator for data entry. Thirdly, the hospital laboratory provides a monthly download of laboratory test details (e.g. HbA1c). A patient can be identified as having diabetes and added to the register by any permutation of one or more of these three routes. Feedback of individual patients' data, including review status, is provided to general practices quarterly. This feedback is 'passive' in that it does not explicitly prompt either patients or doctors as to required actions. Audit packages within the software can audit on every variable collected. District wide audit is provided on anonymised aggregated data; individual practice audits (with comparisons to other practices) are provided to participating practices at least annually. Feedback of the data to the patient (for hospital patients only) is by a patient information sheet and to the GP as a standardised letter. A Diabetes Register Facilitator co-ordinates and updates the register. A steering group composed of GH, the Diabetes Register Facilitator and representatives of the PCGs and patients, oversees the register and deals with issues such as confidentiality. Impact of the system to date | Measures of the impact of the system to date relate only to Hartlepool, Easington and Stockton. The main impact on patient registration was in its first 12 to 18 months of operation: during 1995, 747 patients were registered on the system (0.4% prevalence) which had increased to 3867 (1.8% prevalence) by the end of 1996. The increase in registration has stabilised since then, reaching 4324 (2% prevalence) by 1999. During 1999, 70% of registered patients attended a clinic; 52% had their feet examined and 51% had their eyes examined. Seventy three per cent had an HbA1c result recorded and 69% a blood pressure measurement. These figures are similar to those reported by other centres using the same system . The need for an extended system | Recording of clinical measures increased during the first few years of operation of the system but began to plateau more recently (for example, 50% of patients had an HbA1c recorded during 1996, compared to 60% in 1997 and 63% in 1998). This plateauing of performance has been reported by others . We believe that this is due to a lack of coordination (patients being lost to follow up) and lack of prompting of clinicians to deliver appropriate clinical interventions. Furthermore, given that most patients with diabetes are primarily seen in primary care the greatest potential impact is from optimising and extending the system in primary care. In order to address these shortcomings the additional key components, over and above those already in the system, will be: 1. Locally adapted evidence based guidelines for the management and follow up of patients with diabetes. 2. Automated prompts to patients and primary care clinicians that a review consultation is necessary. 3. A structured management sheet (including patient specific management suggestions based on (1)). 4. An enhanced monitoring system to follow up reasons for non-attendance from both patients and clinicians and to re-schedule appointments, based on nonreturn of a completed management sheet. 5. Patient feedback for patients in primary care. There is some limited supportive trial evidence for these developments, although the existing studies involved small sample sizes and may not be generalisable to the NHS . In evaluating the system with these extended features this study will also address the design shortcomings of previous studies of shared care in diabetes . It will be tailored to each practice, PCG defined areas will be studied, rather than an unrepresentative sample of general practices; and the system will be transparent and replicable in other areas. Methods : Design of the study | The study design is a pragmatic two-arm cluster randomised controlled trial. The unit of randomisation will be the general practice. Simple patient randomised trials are rightly considered the most robust method of assessing most health care innovations . This design, however, cannot be regarded as the gold standard for evaluating systematic approaches to chronic disease management, an essentially behavioural field of research . If both intervention and control patients were to be cared for within the same practice there is the risk that the management of control patients would be influenced by the practitioners knowledge of the care of intervention patients. This would result in an underestimation of the effect of the intervention . Therefore, practices rather than patients are the appropriate unit of randomisation and analysis. As the current system has been in place for different lengths of time within the three participating PCGs, we will stratify the randomisation by PCG. Randomisation will be performed by a statistician independent of the research team using computer generated numbers to avoid allocation bias . Study setting and recruitment of practices | The study will be based in the general practices of the three PCGs of Easington, Hartlepool and Stockton. Since the recent merger of Hartlepool and North Tees Acute Trusts all three PCGs are now exclusively served by one secondary care diabetes service (and thus the one diabetes register). GH is the lead clinician for diabetes services in the new Trust. The 61 general practices in the three PCGs constitute the target practices for the study and we will attempt to recruit all practices. The PCG diabetes leads or the PCG clinical governance leads in all three PCGs have provided letters confirming their support for the project. We do not envisage major difficulties with recruitment, given the need to agree local guidelines as part of the process involved in the Trust merger, the likely requirements in the forthcoming National Service Framework for diabetes, and the 100% practice coverage with the current diabetes system. We will (through the PCGs) write to all practices, giving information about the project to the senior partner or diabetes lead and practice manager of practices. Practices will be invited to opt out if they do not wish to be included in the study -- this is an approach we have used successfully before. The PCG diabetes lead, clinical governance lead and GH will be co-signatories of this letter. If practices do decline we will collect data on characteristics of non-participating practices to assess the impact on the generalisability of the trial's findings. Finally, if there are significant problems with recruitment, there are other practices which could be approached in a nearby PCG (South Tyneside) which uses the same software for its diabetes register. Details of the intervention | Local guidelines and management prompts | A guideline development group will be established to develop local guidelines for the management of diabetes, based upon available evidence based guidelines (Scottish Intercollegiate Guidelines Network (SIGN, 1996, 1997a, 1997b, 1997c), and Effective Care Bulletins . They will also use the forthcoming national diabetes guidelines as these become available. The group will be multidisciplinary and contain primary and secondary care doctors and nurses, patients and the Diabetes Register Facilitator . The group will define review periods for specified patient groups (e.g. patients with diabetes satisfactorily controlled on diet alone should be reviewed every 12 months), referral criteria for patients moving from primary to secondary care and back and simple decision rules for the management prompts. These would be of two types. The first would prompt for actions to be performed and only require their performance to be documented (e.g. asking for a foot examination to be performed in a patient who does not have a recorded foot examination). The second would be more complex and suggest alterations to clinical management on the basis of data in the database (e.g. patients with persistently raised blood pressure should have their anti-hypertensive medication increased). These decision rules will be integrated into the recall and management system. Running the system | The proposed enhancements to the system are designed to require the primary care team to perform no additional work over and above the current configuration. The current database has a patient identifier, a minimum dataset and retrieval systems to support the structured recall of patients. Westman Medical Software has agreed to amend the system as required. A 'circle of information exchange' will be established between the participating general practices and the database. The local guidelines will be used to adapt the current centralised database, along with the practices' preferred method of following up patients (for example, within consultations in routine surgeries or within special clinics). The central database system will identify when patients are due for review (based upon the local guidelines) and will generate a letter to the patient asking them to make an appointment for a review consultation. Patient information or educational materials could be included with the letter. At the same time, the central database will generate a letter to the practice stating that the patient should be making a review appointment in the near future. The letter to the practice will include a management sheet (to be held in the patient's record) to capture an agreed minimum data set to be collected during the consultation. This management sheet will also contain the relevant prompts (as described above). When the patient is seen in the practice, the primary care professional (currently this is usually done by the practice nurse) will complete the management sheet and return a copy for entry onto the central register within a designated period of time. This circle of information is broken if the patient does not visit the general practice as planned or the general practice does not return the management sheet to the central register. If this happens, the central register would alert the Diabetes Register Facilitator who will ascertain the reason for failure and take appropriate action, (e.g. send a reminder to the patient, prompt the practice to return the management sheet). A range of educational activities will be provided for intervention practices, as part of the usual local structures for contact with practices, with some additions, These will include: distribution of information about the trial in local newsletters; meetings with practice clinical governance leads; evening meetings for practice nurses (with small group discussion of the practical implications for intervention practices); and a telephone meeting with the practice diabetes lead (usually the practice nurse) in each intervention practice. Practices in the control arm will continue to receive the recall system as currently configured. Logistical considerations | From the prevalence of patients with diabetes on the current register, there will be about 7500 patients on the system if 61 practices are recruited. Half of these will be in intervention practices. On current patterns of usage, we anticipate there being the need for 1.5 recalls per annum per patient on the register, resulting in about 6000 recalls per year for the intervention group. Assuming a 40 week working year, the system will need to dispatch, receive and process about 150 forms per group per week. Identification of patients | Patients for the structured recall and management system are already identified on the Hartlepool and North Tees database. As some practices have children registered on the system, who are under the care of an exclusively secondary care adolescent service, an age limit of 18 years or over will be set for inclusion. Practices will be asked to check lists of their patients on the database regularly throughout the study. The central database will remove patients from the recall system who are known to have died or moved away. Patient consent | Patients have already consented, or are being consented, to their data being held within the current diabetes register. The study will involve no extra 'routine' data being collected, and this data will be anonymised before being sent for analysis; all data held for analysis will be held in accordance with the Data Protection Act. For the patient-based questionnaire study, we will seek additional patient consent to complete one survey. The three relevant Local Research Ethics Committees have approved the trial. Data collection | The main study outcome measures will be rates of performance of process of care and the patient based measures of functional and psychosocial wellbeing. Data will be collected for 15 months after the start of the intervention. Fifteen months was chosen to allow for patients who are reviewed every 12 months but fail to attend on initial invitation. Process of care variables | Process of care variables will be collected via the computerised database. The exact data to be collected will be determined by both the current content of the database and the guidelines but will include such data items as rates of attendance at clinics and annual reviews, conduct of eye and feet examinations, performance of investigations and prescribing. We will also collect data on clinical measures (e.g. HbA1c, and blood pressure levels). Outcome of care measures | Outcome of care data will be collected, by postal questionnaire, 15 months after commencement of the study. A portfolio of validated and responsive generic and disease specific instruments will be used to measure functional and psychosocial variables that will be potentially influenced by the intervention. These will include: i) The SF36 health status profile which we will use to generate Mental (MCS) and Physical Component Summary Scales (PCS) . ii) The Newcastle Diabetes Symptoms Questionnaire . iii) The Bradley Treatment Satisfaction Questionnaire . Patient costs questions will be developed by the study health economist. We have successfully used such packages of questionnaires within trials before and have achieved response rates in excess of 70% in similar surveys in this region. . Sample size considerations | On the basis of previous work we have made the following assumptions. The mean number of patients per practice for whom we will be able to collect process data will be 30 and the ICC (a measure of the lack of independence of responses from patients from the same practice) calculated from our local data is 0.14 for measures of process (whether a blood pressure measurement and whether an HbA1c measurement has been recorded in a 12 month period). Standard methods for determining the sample size requirements for a cluster randomised trial indicate that we need 60 practices to detect a difference of 15% (42.5% v 57.5%) with 80% power assuming a significance level of 5%. Assessment of outcome of care will be based on health status scales such as the SF-36. Previous work has shown that this type of intervention is likely to produce an effect size of approximately 0.25 in such measures and that the ICCs for such measures will be approximately 0.07. The most efficient study design (that minimises the number of patients required) is one that makes use of all the available practices. A sample of 27 patients from each of 61 practices will give us 85% power to detect an effect size of 0.25 assuming a significance level of 5%. With a predicted response rate of approximately 70% (based on our experience in the COGENT study ) after two reminders, our starting sample size will need to be 2379 patients (approximately 39 patients per practice). Principles of data analysis | Analysis will be by intention to treat. Multilevel modelling (using the MlwiN package ) will be used to take into account the clustering of patients within practices . Both binary variables (when a process was undertaken or not) and continuous variables (such as the physical health component of the SF-36) can be analysed using these techniques. For both types of variable, variation between practices will be fitted as a random effect and the difference between intervention and control practices will be fitted as a fixed effect. In the case of binary variables, a logit link function will be used. Economic evaluation | The economic impact of implementing the new structured recall and management system will be evaluated in terms of the marginal costs of adapting and running the system; the costs of developing and disseminating the guidelines; the educational activities for intervention practices; the implications for the use of health care services; and the costs to the patients and their carers. The benefits will be measured as described earlier on in the clinical study. The estimation of health service resource use will relate to diabetes-specific clinical visits, tests, investigations, and procedures. This data will be routinely collected as part of the management system implementation and subsequent costing, using health service pay and price data, will be undertaken using a mixed approach based on micro-costing and gross-costing methods . Use of drugs, referrals to secondary care and the impact of the intervention on the change of use of patients' and their carers' time will also be monitored through postal questionnaires at the end of the follow-up period. A sensitivity analysis will be undertaken to test the robustness of the results to the uncertainty not related to sampling variations and to enhance the generalisability of the results . We are aware that the costs of the system might be balanced only in the longer term against the cost savings related to averted complications . However, the assessment of the benefits in terms of final outcomes (e.g lives saved, or QALYs) and long term costs is beyond the objective of the present study. Competing interests : None declared Pre-publication history : The pre-publication history for this paper can be accessed here: Backmatter: PMID- 11914164 TI - Inter-rater agreement in the scoring of abstracts submitted to a primary care research conference AB - Abstract | Background | Checklists for peer review aim to guide referees when assessing the quality of papers, but little evidence exists on the extent to which referees agree when evaluating the same paper. The aim of this study was to investigate agreement on dimensions of a checklist between two referees when evaluating abstracts submitted for a primary care conference. Methods | Anonymised abstracts were scored using a structured assessment comprising seven categories. Between one (poor) and four (excellent) marks were awarded for each category, giving a maximum possible score of 28 marks. Every abstract was assessed independently by two referees and agreement measured using intraclass correlation coefficients. Mean total scores of abstracts accepted and rejected for the meeting were compared using an unpaired t test. Results | Of 52 abstracts, agreement between reviewers was greater for three components relating to study design (adjusted intraclass correlation coefficients 0.40 to 0.45) compared to four components relating to more subjective elements such as the importance of the study and likelihood of provoking discussion (0.01 to 0.25). Mean score for accepted abstracts was significantly greater than those that were rejected (17.4 versus 14.6, 95% CI for difference 1.3 to 4.1, p = 0.0003). Conclusions | The findings suggest that inclusion of subjective components in a review checklist may result in greater disagreement between reviewers. However in terms of overall quality scores, abstracts accepted for the meeting were rated significantly higher than those that were rejected. Keywords: Background : Interest in the peer review process and research aimed at determining the method of obtaining the best quality reviews has grown in recent years. Checklists have been developed that aim to guide reviewers when assessing the quality of papers, but little evidence exists concerning the extent of agreement between two referees when evaluating the same paper. In addition, little is known about which dimensions of a checklist are likely to result in greater agreement between referees. There were two aims of this study: (1) to examine inter-rater agreement of the quality of abstracts submitted to a primary care research conference (Annual Meeting of the South West Association of University Departments of General Practice, Exeter 2000, UK), and (2) to compare the scores of abstracts accepted and rejected for the meeting. Materials and Methods : Abstracts were anonymised and scored using a structured assessment comprising seven categories: (1) importance of the topic (2) originality (3) overall quality of the study design (4) appropriateness of the design used (5) achievement of aim (6) contribution to academic primary care (7) likelihood of provoking discussion. For comparison purposes, we have classified the assessment of categories 1, 2, 6 and 7 as more 'subjective' in nature, and categories 3, 4 and 5 as more 'objective'. Between one (poor) and four (excellent) marks were awarded for each category, giving a maximum possible score of 28 marks. Every abstract was assessed independently by two referees (AM and AG). Agreement between referees was assessed using intraclass correlation coefficients (ICC), a chance corrected measure of agreement. The ICC indicates perfect agreement only if the two assessments are numerically equal and is preferable to the more usual (Pearson) correlation coefficient. The crude ICC is lowered by any systematic differences between referees' scores. In terms of a plot of the two referees' scores, a line with a non-zero intercept will further lower the ICC irrespective of any disagreement, represented by deviation of the slope of the line away from unity and scatter around the line. In a further analysis, this effect was investigated by subtracting the mean difference for each component from the higher of the two referees' scores. The ICCs were then recalculated, giving estimates of agreement corrected for both systematic differences and chance. There are no universally applicable standard values for the ICC that represent adequate agreement, but the following convention is used here to aid interpretation: ICC <0.20 'slight agreement'; 0.21 --0.40 'fair agreement'; 0.41 --0.60 'moderate agreement'; 0.61 --0.80 'substantial agreement'; >0.80 'almost perfect agreement'. Scores from referees from three different institutions were summed to give each abstract an overall score. Abstracts were ranked by this overall score and the top 45 were accepted for oral presentation at the meeting. Of the 52 abstracts refereed by AM and AG, mean total scores of those accepted and rejected for the meeting were compared using an unpaired t test. Results : Chance corrected agreement between the two referees' scores measured using crude ICCs was greater for the three components relating to design and execution of the study (Table : items 3 to 5) compared to those relating to more subjective elements of the abstract (Table : items 1, 2, 6, 7). After adjustment for systematic differences in referees' scores, ICCs for items 3 to 5 remained highest, demonstrating fair to moderate agreement. Table 1 | Inter rater agreement between two referees for 52 abstracts submitted for a primary care research conference A total of 76 abstracts were submitted for the meeting. Of 52 received by the authors for assessment, 26 were accepted for oral presentation . Abstracts accepted for the meeting had a significantly higher mean score than those that were rejected (95% CI for difference 1.3 to 4.1, p = 0.0003) . Table 2 | Summary statistics of abstracts accepted and rejected for oral presentation at a primary care research conference Discussion : This study has shown that when using a structured assessment form, two independent reviewers were more likely to agree on design or methodological components of a checklist than on subjective components of abstracts submitted for an annual research meeting. Abstracts accepted for the meeting had significantly higher total scores, but overlapped considerably with rejected abstracts. This was due to acceptance for the meeting being determined by an overall aggregate of scores awarded by referees from three institutions. While the subject of inter-reviewer agreement on different components of a checklist is relatively under-researched, some previous studies offer support for our finding that agreement is better when reviewers can be more objective in their assessments. Among a group of reviewers asked to rate a series of review articles, agreement on scientific quality of the papers was very high (60% of ICCs > 0.7) both within and between groups with varying levels of research training and expertise. All 10 dimensions of the checklist that reviewers rated could be regarded as objective. Divergent reviewers have been identified in a study comparing an overall rating score that indicated a recommendation to publish rather than individual dimensions of a review checklist. This study does have limitations. Importantly, we assessed agreement between only two reviewers on a relatively small number of abstracts. This could be addressed by having more abstracts assessed by a greater number of reviewers. However the study was conducted pragmatically within the time and administrative constraints of a small annual scientific meeting rather than submissions to a journal over an extended period. Another limitation is that the reviewer checklist was constructed prior to conceiving the study. If future meetings are to be used to investigate the content of structured reviewer assessments, such checklists should be constructed with specific hypotheses in mind. Characteristics associated with good peer review are age under 40 years and training in epidemiology or statistics, characteristics that applied to both reviewers in the present study. Structured assessment forms that ask the reviewer for their opinion of a paper's interest, originality or likelihood of provoking discussion may be more likely to result in scores that reflect the reviewer's own research interests. This is not necessarily a criticism -- it is perhaps only natural that individuals will differ in their opinions of how interesting they find, and think others will find, a particular paper. It is interesting that the two components with the lowest agreement, importance of the topic and originality of the study, both require more knowledge about a specific subject area than either of the other two subjective questions. Journal editors and meeting organisers should be aware that including subjective components in review checklists may result in greater disagreement between reviews. Conclusions : This study provides some evidence that inclusion of subjective components in a review checklist may result in greater disagreement between reviewers. An interesting area for further research would be to investigate the effects of attaching different weights to subjective and objective components of a checklist, or to exclude subjective components altogether from overall quality scores and simply use them a guide to acceptance or rejection. Competing interests : None declared. Figure 1 | Difference between referees' scores versus mean score Difference between referees' scores versus mean score Pre-publication history : The pre-publication history for this paper can be accessed here: Backmatter: PMID- 11943069 TI - The Caenorhabditis elegans Y87G2A.14 Nudix hydrolase is a peroxisomal coenzyme A diphosphatase AB - Abstract | Background | The number of Nudix hydrolase family members varies widely among different organisms. In order to understand the reasons for the particular spectrum possessed by a given organism, the substrate specificity and function of different family members must be established. Results | The Y87G2A.14 Nudix hydrolase gene product of Caenorhabditis elegans has been expressed as a thioredoxin fusion protein in Escherichia coli and shown to be a CoA diphosphatase with catalytic activity towards CoA and its derivatives. The products of CoA hydrolysis were 3',5'-ADP and 4'-phosphopantetheine with Km and kcat values of 220 muM and 13.8 s-1 respectively. CoA esters yielded 3',5'-ADP and the corresponding acyl-phosphopantetheine. Activity was optimal at pH 9.5 with 5 mM Mg2+ and fluoride was inhibitory with a Ki of 3 muM. The Y87G2A.14 gene product has a potential C-terminal tripeptide PTS1 peroxisomal targeting signal -- SKI. By fusing a Y87G2A.14 cDNA to the C-terminus of yeast-enhanced green fluorescent protein, the enzyme appeared to be targeted to peroxisomes by the SKI signal when transfected into yeast cells. Deletion of SKI abolished specific targeting. Conclusions | The presence of related sequences with potential PTS1 or PTS2 peroxisomal targeting signals in other organisms suggests a conserved peroxisomal function for the CoA diphosphatase members of this group of Nudix hydrolases. Keywords: Background : The Nudix hydrolase family comprises enzymes that hydrolyse predominantly the diphosphate (pyrophosphate) linkage in a variety of nucleoside triphosphates, dinucleoside polyphosphates, nucleotide sugars and nucleotide cofactors having the general structure of a nucleoside diphosphate linked to another moiety, X . They are found in archaea, eubacteria, animal, plants, and fungi and all possess the Nudix box sequence signature motif Gx5Ex5 [UA]xREx2EExGU (where U is an aliphatic hydrophobic amino acid) . The proposed functions of this family are to eliminate potentially toxic nucleotide metabolites from the cell and to regulate the concentrations of nucleotide cofactors and signalling molecules for optimal cell growth and survival. The number of genes encoding Nudix hydrolases varies widely, from zero in Mycoplasma genitalium to 22 in Deinococcus radiodurans. This variation presumably reflects the growth or environmental adaptability, stress tolerance and metabolic capacity of the different organisms. The Nudix hydrolases thus offer an ideal system with which to study the evolution of a largely inessential protein family and its contribution to the individual biology of an organism. Understanding such variation requires a combination of detailed biochemical, genetic and cellular studies to reveal the individual functions of family members within the set in any given system. In the case of multicellular eukaryotes, the nematode Caenorhabditis elegans offers a genetically amenable model system with which to carry out such studies. There are 11 members of the Nudix hydrolase family in C. elegans. So far only two of these have been characterized -- a diadenosine tetraphosphate pyrophosphohydrolase (the orthologue of human NUDT2) and an NADH diphosphatase . Sequence comparisons would predict the existence of an ADP-sugar diphosphatase (NUDT5 orthologue) , an ADP-ribose diphosphatase (NUDT9 orthologue) , a diphosphoinositol polyphosphate pyrophosphohydrolase (NUDT3/4 orthologue) , two probable coenzyme A diphosphatases, one of which is highly similar to the mouse Nudt7 CoA diphosphatase , and 4 proteins of unknown function, including one with a strong similarity to the Saccharomyces cerevisiae PSU1/DCP2 protein and another similar to the developmentally-regulated mouse RP2 protein . Recent characterization of the S. cerevisiae NADH and CoA diphosphatases and the mouse Nudt7 CoA diphosphatase has revealed that they are located in peroxisomes. The function of these peroxisomal enzymes may be to regulate the concentration of these essential nucleotide cofactors for peroxisomal metabolism or, by analogy with the E. coli MutT 8-oxo-dGTPase, to eliminate toxic modified cofactor metabolites from the highly oxidizing peroxisomal environment. In order to investigate these possibilities in the C. elegans model system, we have cloned and characterised the putative C. elegans Y87G2A.14 CoA diphosphatase and shown that it displays the expected enzymatic activities and that it appears to be targetted to peroxisomes by a C-terminal PTS1 targeting signal. Results and discussion : Cloning, expression and purification of Y87G2A.14 | The C. elegans Y87G2A.14 gene encodes a 234 amino acid protein with an expected molecular weight of 26,601 Da. It was amplified by PCR from a C. elegans cDNA library. The PCR fragment was inserted into the pET-32b(+) expression vector and the nucleotide sequence of the insert was determined to be exactly the same as that submitted to GenBank under accession no. CAB54476. The recombinant plasmid pETY87G2A.14 was then used to transform E. coli BL21 (DE3) cells to generate a His-tagged thioredoxin fusion protein with an expected molecular mass of 43,731 Da. When the Trx-Y87G2A.14 fusion protein was expressed at 37C, it was confined to inclusion bodies, so the induction temperature was decreased to 25C to enhance protein solubility. As the expression level was low at this temperature, the induction time was increased to 8 h. These conditions markedly increased the solubility of Trx-Y87G2A.14 which was then purified from the soluble fraction (Fig , lane 2) to apparent homogeneity on NiCAMTM-HC resin (Fig , lane 3). To determine the molecular weight of the Y87G2A.14 protein itself, the Trx-Y87G2A.14 fusion was cleaved with thrombin, which generated Y87G2A.14 with an apparent molecular weight of 27 kDa (expected molecular weight, 29,807 Da) and thioredoxin (15 kDa, Fig , lane 4). Figure 1 | Purification and cleavage of Trx-Y87G2A.14 fusion protein. Purification and cleavage of Trx-Y87G2A.14 fusion protein. Samples were analysed by SDS-PAGE (15% polyacrylamide) and stained with Coomassie Brilliant blue R 250. Lane 1, 2 mug protein standards: bovine serum albumin (66 kDa), ovalbumin (45 kDa), glyceraldehyde 3-phosphate dehydrogenase (36 kDa), carbonic anhydrase (29 kDa), trypsinogen (24 kDa), soybean trypsin inhibitor (20 kDa) and alpha-lactalbumin (14.2 kDa); lane 2, soluble cell extract of BL21 (DE3) cells transformed with recombinant plasmid pETY87G2A.14 and induced with 1 mM IPTG for 8 hours at 25C before applying to a column of NiCAMTM-HC resin ; lane 3, 3 mug purified Trx-Y87G2A.14 fusion protein; lane 4, 3 mug purified Trx-Y87G2A.14 fusion protein after cleavage with thrombin. Substrate specificity and product analysis | Purified Trx-Y87G2A.14 was inactive towards the following nucleotides when assayed at a fixed concentration of 0.5 mM: NADH, NAD+, NDP-sugars, 5'-(d)NTPs, 5'-NDPs, 5'-NMPs and diadenosine polyphosphates. High activity was found with CoA and its derivatives. HPLC analysis of CoA hydrolysis by Trx-Y87G2A.14 showed that the enzyme was a CoA diphosphatase, cleaving the diphosphate linkage in CoA to yield adenosine 3',5'-bisphosphate (3',5'-ADP) and 4'-phosphopantetheine . Figure 2 | Identification of reaction products of CoA hydrolysis. Identification of reaction products of CoA hydrolysis. Reaction mixtures containing 0.5 mM CoA were incubated at 37C for 20 min with or without 0.1 mug Trx-Y87G2A.14 fusion protein and the products separated by HPLC as described in Materials and methods. Without enzyme (------), with enzyme , gradient ( --- --- --- --- ---). Positions of authentic standards are indicated. Reaction requirements and kinetic parameters | Trx-Y87G2A.14 displayed optimal activity with 0.5 mM CoA as a substrate at pH 9.5. A divalent metal ion was absolutely required for activity, with optimal activity at 5 mM MgCl2. In common with all other Nudix hydrolases tested, fluoride was a strong inhibitor with a Ki value of approximately 3 muM (results not shown). Km, and kcat values for CoA, CoA esters and oxidized CoA were calculated by non-linear regression from data obtained by HPLC analysis . A graphical example of the data for CoA in the form of a hyperbolic plot and double reciprocal plot show that the enzyme obeys simple Michaelis-Menten kinetics. The kcat / Km ratios show that the enzyme prefers reduced forms of CoA to oxidized CoA with CoA itself the best substrate of those tested. Figure 3 | Lineweaver-Burk and Michaelis-Menten (inset) plots for the hydrolysis of CoA. Lineweaver-Burk and Michaelis-Menten (inset) plots for the hydrolysis of CoA. Reaction mixtures containing various concentrations of CoA (0.05 --0.7 mM) were incubated at 37C for up to 20 min with 0.1 mug Trx-Y87G2A.14 fusion protein. Initial rates of hydrolysis were determined after separation of the products by HPLC as described in Materials and methods. Table 1 | Kinetic parameters for the hydrolysis of CoA and CoA derivatives by Trx-Y87G2A.14 fusion protein Subcellular localization | Y87G2A.14 has the C-terminal tripeptide sequence SKI. This conforms to the pattern typical of PTS1 peroxisomal targeting signals found in many peroxisomal matrix proteins, suggesting that Y87G2A.14 may be targeted to these organelles . However, possession of a potential PTS1 sequence is not always sufficient on its own to result in peroxisomal targeting and other elements of the protein sequence may also be involved. Since targeting of animal peroxisomal proteins expressed in yeast has often been observed, yeast cells were transformed with expression plasmids encoding C-terminal or N-terminal fusions of Y87G2A.14 to yeast-enhanced green fluorescent protein (yEGFP) in order to determine the subcellular location of Y87G2A.14. The cells were then examined by confocal microscopy. Cells transformed with pY87G2A.14-yEGFP, in which the C-terminus of Y87G2A.14 is fused to the N-terminus of yEGFP, showed a diffuse, cytoplasmic fluorescence with no clear subcellular localization . In contrast, cells transformed with pyEGFP-Y87G2A.14, in which the C-terminal tripeptide SKI is free to act as a targeting signal showed the clear punctate fluorescence that is indicative of yeast peroxisomes . The identity of SKI as the targeting signal was confirmed by transformation of cells with pyEGFP-Y87G2A.14Delta SKI, in which the C-terminal tripeptide was deleted during construction. This again showed a diffuse, cytoplasmic, fluorescence . Together, these results strongly suggest that Y87G2A.14 is targeted to peroxisomes by its C-terminal tripeptide, SKI. Figure 4 | Subcellular localization of Y87G2A.14 by fluorescence confocal microscopy. Subcellular localization of Y87G2A.14 by fluorescence confocal microscopy. yEGFP fluorescence of yeast cells transformed with (a) pY87G2A.14-yEGFP; (b) pyEGFP-Y87G2A.14 and (c) pyEGF-Y87G2A.14DeltaSKI Conclusions : On the basis of its sequence, the C. elegans Y87G2A.14 gene product was predicted to be a peroxisomal coenzyme A diphosphatase. In addition to the Nudix motif, Y87G2A.14 possesses the PROSITE UPF0035 motif , which we have previously suggested confers a specificity for coenzyme A and its derivatives , and a C-terminal tripeptide, SKI, that conforms to the pattern typical of PTS1 peroxisomal targeting signals. The experiments described here confirm these predictions. Fig shows a multiple sequence alignment of the motif-containing region of Y87G2A.14 with related sequences from other organisms. Those marked with a tick have been experimentally shown to be coenzyme A diphosphatases . In most cases, higher organisms possess two related sequences, e.g. mouse Nudt7 and Nudt8, one of which encodes a peroxisomal enzyme (e.g. Nudt7). However, S. cerevisiae has only one sequence containing the UPF0035 motif while Arabidopsis thaliana has three, and the second of the two Drosophila melanogaster sequences, RH61317, is currently only represented in GenBank by a single expressed sequence tag, so its status is still questionable. For the peroxisomal enzymes, either a putative C-terminal PTS1 or an N-terminal PTS2 targeting signal is present. Interestingly, in each case, the putative PTS2 signal is contained within or near a predicted mitochondrial targeting or chloroplast transit peptide sequence , suggesting a possible dual location for these proteins. Such a possibility has not yet been experimentally observed; however, mutation of a glutamate five residues to the C-terminal side of the PTS2 of rat peroxisomal 3-ketoacyl-CoA thiolase to a neutral or basic amino acid has been shown to result in partial mitochondrial targeting, suggesting that the negative charge on glutamate may normally block translocation to the mitochondria . Whether or not a system exists in vivo to regulate dual targeting is clearly a topic requiring further investigation. The non-peroxisomal sequences provide no clear indication of possible subcellular location, hence they are likely to be cytoplasmic. Given the existence of mitochondrial, peroxisomal and cytoplasmic pools of CoA and CoA esters , it would not be surprising to find CoA diphosphatase activity in all these locations. However, the precise substrate specificities of the "cytoplasmic" activities remain to be determined. Figure 5 | Partial sequence alignment of Y87G2A.14 and related sequences. Partial sequence alignment of Y87G2A.14 and related sequences. The partial sequence of Y87G2A.14 containing the UPF0035 and Nudix motifs (arrowed) was aligned using the Clustal W program with related sequences from other organisms retrieved from a BLAST search. Organisms and database accession numbers are: Caenorhabditis elegans Y38A8.1, Q23236; Homo sapiens NUDT7, XP_058753; H. sapiens NUDT8, AI743601; Mus musculus Nudt7, Q99P30; M. musculus Nudt8, AK009700; Drosophila melanogaster CG11095, Q9VY79; D. melanogaster RH61317, BI631687; Schizosaccharomyces pombe YDH5, Q92350; S. pombe YDZA, 013717; Ambidopsis thaliana At2g33980, 022951; A. thaliana At1g28960, Q9SHQ7; A. thaliana At5g45940, BAB09322; Saccharomyces cerevisiae PCD1, Q 12524; Escherichia coli YeaB, P43337; Deinococcus radiodurans DR1184, Q9RV46. Sequences encoding experimentally confirmed CoA diphosphatases are marked with a tick. Columns on the right indicate whether the full sequence contains a putative peroxisomal targeting signal (PTS1 or PTS2) and/or a putative mitochondrial targeting peptide (mTP) or chloroplast transit peptide (cTP). Regarding the possible function of these enzymes in general, and the C. elegans peroxisomal enzyme in particular, a recent functional genomic analysis by RNA-mediated interference of C. elegans chromosome I, on which the Y87G2A.14 gene is located, revealed no phenotype in relation to growth, survival, fecundity or morphology when the expression of Y87G2A.14 was ablated . This would indicate that, within the limitations of RNAi, the CoA diphosphatase activity of Y87G2A.14 is not essential. However, now that the biochemical properties of this protein have been established, a more detailed and targeted biochemical analysis can be undertaken that should reveal its cellular function and benefit to the organism. Nudix hydrolases are believed to regulate the concentrations of nucleotides for optimal cell performance and also to eliminate potentially toxic nucleotide metabolites from the cell. With regard to regulation, CoA diphosphatase activity is associated with the 400 kDa CoA synthesizing protein complex from S. cerevisiae, in which it forms part of an alternative pathway for CoA biosynthesis that differs from the principal route of 3'-dephospho-CoA and CoA synthesis by this complex . This CoA/4'-phosphopantetheine cycle involves hydrolysis of CoA to 3',5'-ADP and 4'-phosphopantetheine, which then reacts with ATP to give 3'-dephospho-CoA then CoA. Whether such a pathway operates in peroxisomes and whether the C. elegans Y87G2A.14 protein is involved remain to be established. With regard to the elimination of toxic nucleotide metabolites, the 13-fold higher kcat / Km ratio for oxidized CoA (CoASSCoA) compared to CoA for the S. cerevisiae PCD1 CoA diphosphatase previously suggested to us that this enzyme might preferentially remove non-functional and potentially toxic oxidized CoA and CoA esters from within the oxidizing environment of the peroxisomes . However, neither the mouse Nudt7 nor the C. elegans Y87G2A.14 proteins show this preference. Nevertheless, the potential production of adenine ring-oxidized derivatives of CoA by reactive oxygen species generated in the peroxisomes analogous to the 2-oxo-dATP and 8-oxo-dATP substrates of the mammalian MTH1 Nudix hydrolase suggests that such species could be more relevant substrates for peroxisomal CoA diphosphatases in vivo. The amenability of C. elegans to studies of cellular and molecular stress will allow the question of the biological function of these enzymes to be addressed. Materials and methods : S. cerevisiae strain BY4741 (MAT a; his3D1; leu2D0; met15D0; ura3D0) was from Research Genetics. Calf intestinal alkaline phosphatase, yeast inorganic pyrophosphatase, EcoR1 and BamH1 were from Roche while BspH1 (Pag1) was from Helena Biosciences. Pfu DNA polymerase was from Stratagene. All other chemicals and nucleotides were from BDH or Sigma. The E. coli expression vector pET-32b(+) was from Novagen and the yeast-enhanced green fluorescent protein (yEGFP) fusion vectors pUG35 and pUG36 were a gift from J.H. Hegemann, Institute of Microbiology, University of Dusseldorf, Germany. The C. elegans cDNA library was prepared from adult nematodes by H. M. Abdelghany, School of Biological Sciences, University of Liverpool, U.K. Cloning of Y87G2A.14 from C.elegans | A cDNA corresponding to the C. elegans Y87G2A.14 gene on chromosome 1 (GenBank accession no. CAB54476) was amplified from a cDNA library by PCR using as forward and reverse primers 5' GCAAATCATGAAGTGTGTGGTTAGCCGAGCTG 3' and 5' TAAATGAATTCACTAAATTTTGGATTTCGGTTC 3' respectively. These primers provided a BspH1 restriction site at the start of the amplified gene and an EcoR1 site at the end. After amplification with Pfu DNA polymerase, the DNA was recovered by phenol/chloroform extraction and digested with BspH1 and EcoR1. The digest was gel-purified and the restriction fragment ligated into the Nco1 and EcoR1 restriction sites of pET-32b(+) as both BspH1 and Nco1 form compatible ends with each other. The resulting construct, pETY87G2A.14, yielded Y87G2A.14 downstream of the 109-amino acid thioredoxin (Trx) fusion and His-tag and S-tag sequences under the control of an IPTG-inducible promoter. The structure of the insert was confirmed by sequencing. The construct was propagated by transformation of E. coli XL1-Blue cells. Expression of Y87G2A.14 in E. coli and protein purification | E. coli strain BL21(DE3) was transformed with pETY87G2A.14. A single colony was picked from an LB agar plate containing 50 mug/ml ampicillin and inoculated into 10 ml LB medium containing 50 mug/ml ampicillin and incubated at 37C. When the cells reached an A600 of 0.5, they were transferred to 1 litre of fresh LB medium containing 50 mug/ml ampicillin and grown to an A600 of 0.3 at 37C, then transferred to an incubator at 25C. Isopropyl-1-thio-beta-D-galactopyranoside (IPTG) was added to 1 mM at an A600 of 0.8, and the cells induced for 8 h. The induced cells (4 g) were harvested, washed and resuspended in 20 ml breakage buffer (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM DTT). The cell suspension was sonicated and the cell lysate was then cleared by centrifugation at 10,000 x g at 4C for 15 min. The supernatant was applied to a 15 x 50 mm column of NiCAMTM-HC resin (Sigma) equilibrated with 50 mM Tris-HCl, pH 8.0, 0.5 M NaCl, 1 mM 2-mercaptoethanol at a flow rate of 0.5 ml/min. After eluting the unbound proteins, a linear gradient of 0 --40 mM histidine in the same equilibration buffer was applied at flow rate of 1 ml/min and 1 ml fractions collected and analysed by SDS-PAGE. Those containing pure Trx-Y87G2A.14 fusion protein were collected, dialysed overnight at 4C against 1 litre of 20 mM Tris-HCl, pH 8.0, 50 mM NaCl, ImM DTT and then concentrated by ultraflltration (Amicon) and stored at -20C in 50% glycerol. Enzyme assays | Potential substrates were screened by measuring the Pi released after nucleotide hydrolysis in presence of inorganic pyrophosphatase or alkaline phosphatase . The standard assay (200 mul) for phosphodiester substrates was incubated at 37C for 30 min and contained 50 mM l,3-bis [tris(hydroxymethyl)-methylamino]propane-HCl (BisTrisPropane-HCl), pH 8.0, 5 mM MgCl2, 1 mM DTT, 0.5 mM substrate, 0.1 mug of Trx-Y87G2A.14 fusion protein and 0.5 mug (1 unit) alkaline phosphatase. Assays with phosphomonoester substrates were as above, except 0.5 mug (100 mU) inorganic pyrophosphatase was used instead of alkaline phosphatase. The Pi released in each case was measured colorimetrically. Chromatographic analysis | Kinetic parameters and reaction products generated from hydrolysis of CoA and its derivatives were measured by high performance anion-exchange chromatography. The reaction mixtures (100 mul) contained 50 mM BisTrisPropane-HCl, pH 9.5, 5 mM MgCl2, 1 mM DTT (in cases of substrates requiring reducing conditions), substrate in the range of 0.05 --0.7 mM, (0.1 --1 mM in the case of oxidized CoA) and were incubated at 37C for up to 20 min (during which time the reaction rates remained linear) with 0.1 mug Trx-Y87G2A.14 fusion protein. A 90 mul sample of each reaction mixture was applied to a 1 ml Resource-Q column (Amersham Pharmacia Biotech) equilibrated with 0.045 M CH3COONH4 (pH 4.6, adjusted with H3PO4), and eluted with a linear gradient from 0 to 0.45 M NaH2PO4 (pH 2.7 adjusted with CH3COOH) for 10 min at a flow rate of 2 ml/min . Elution was monitored at 259 nm and peaks identified with the aid of standards and quantified by area integration. GFP fusion constructs and subcellular localization | Expression plasmids encoding C-terminal and N-terminal fusions of Y87G2A.14 to yeast-enhanced green fluorescent protein (yEGFP) were constructed by amplification of the coding region of Y87G2A.14 from C. elegans cDNA by PCR using the same forward primer 5' CGACGGATCCATGAAGTGTGT 3' and one of the reverse primers 5' TAAATGAATTCACTAAATTTTGGATTTCGGTTC 3', 5' CACTAAGAATTCTATTTCGGTTCAAATTTCCTACTTGC 3', or 5' GCTCGAATGAATTCAATTTTGGATTTCGGTTC 3' to give PCR products "C", "CDeltaSKI" or "N" respectively. These primers provided a BamH1 restriction site at the start of the amplified gene and EcoR1 sites at the end. PCR products "C" and "CDeltaSKI" were cloned as C-terminal fusion proteins to yEGFP, while PCR product "N" with a deletion of the Y87G2A.14 termination codon was cloned as an N-terminal fusion to yEGFP. After amplification with Pfu DNA polymerase, the DNA products were recovered by phenol/chloroform extraction and digested with BamH1 and EcoR1. The digested PCR products "C", and "CDeltaSKI" were gel purified and the restriction fragments ligated between the BamH1 and EcoR1 restriction sites of pUG36 (yEGFP-C-fusion) to give pyEGFP-Y87G2A.14 and pyEGFP-Y87G2A.14DeltaSKI respectively. The digested PCR product "N" was gel purified and the restriction fragment ligated between the BamH1 and EcoR1 restriction sites of pUG35 (yEGFP-N-fusion) to give pY87G2A.14-yEGFP. The structures of the inserts were confirmed by sequencing. The plasmids were propagated by transformation of E. coli XL 1-Blue cells. For microscopy, S. cerevisiae strain BY4741 was transformed with pyEGFP-Y87G2A.14, pyEGFP-Y87G2A.14DeltaSKI or pY87G2A.14-yEGFP and grown on solid SC-Ura medium containing 2% glucose. Cells were viewed by conventional and confocal fluorescent microscopy on a Zeiss LSM510 confocal microscope with a 100 x 1.4 NA objective. Other methods | Protein concentrations were estimated by the Coomassie blue binding dye-based colorimetric method using equal weights of bovine serum albumin, conalbumin, cytochrome c and myoglobin as standards . Backmatter: PMID- 11914163 TI - Outcomes research in the development and evaluation of practice guidelines AB - Abstract | Background | Practice guidelines have been developed in response to the observation that variations exist in clinical medicine that are not related to variations in the clinical presentation and severity of the disease. Despite their widespread use, however, practice guideline evaluation lacks a rigorous scientific methodology to support its development and application. Discussion | Firstly, we review the major epidemiological foundations of practice guideline development. Secondly, we propose a chronic disease epidemiological model in which practice patterns are viewed as the exposure and outcomes of interest such as quality or cost are viewed as the disease. Sources of selection, information, confounding and temporal trend bias are identified and discussed. Summary | The proposed methodological framework for outcomes research to evaluate practice guidelines reflects the selection, information and confounding biases inherent in its observational nature which must be accounted for in both the design and the analysis phases of any outcomes research study. Keywords: Background : The development of practice guidelines | In clinical medicine, variations exist that do not appear to be related to variations in the clinical presentation and severity of disease . In response, practice guidelines have been developed in an attempt to reduce the wide practice variations and, through this process, to increase the appropriateness and quality of medical care and to reduce health care costs . Despite the publication and dissemination of practice guidelines , there has been relatively little evaluation of the application and impact of clinical practice guidelines . Some of the difficulty in the evaluation of these guidelines relates to the methods that were used to develop them . Guidelines have often have been developed before adequate data have been available to assess the relationship between clinical practice patterns and desired clinical outcomes. Nevertheless, there have been some reviews of practice guideline evaluation . While epidemiological designs are commonly used to evaluate the effectiveness of health care interventions, never has this been discussed in the context of outcomes research. We propose the use of a methodological framework for outcomes research to evaluate practice guidelines. Methodological issues with the measurement of practice variations | In the debate about reasons to promote the development of practice guidelines, few have questioned whether the variations are real, or alternatively, whether they are simply a function of methodological flaws in the measurement of medical practices themselves, the result of variations in practice patterns across groups of patients with a similar diagnosis, or both. Furthermore, few studies have addressed whether practice variations, in fact, lead to outcome variations. Finally, little attention has been paid to the identification and measurement of initial conditions, that is, the potentially confounding factors and effect modifiers of the practice patterns outcomes relationship. Measurement of practice pattern variation | The measurement of medical practice patterns is susceptible to error. Measurement error may affect the validity of medical practice measurement in three major ways. First, it may lead to selection bias, in that subjects are selected to belong to a certain group based on an erroneous diagnosis. Secondly, it may lead to misclassification of exposure (information bias), in that patients treated with a specific practice pattern are classified in the wrong diagnostic group. Thirdly, it may lead to misclassification of outcomes, in that patients with a given outcome are classified in the wrong diagnostic group. Potential problems with the measurement of practice variations relate to the mechanisms that underlie the choice of groups that are compared in studies of practice variations. These mechanisms must be defined clearly to minimize selection bias. In many studies of practice variations, populations are arbitrarily divided according to hospitals, regions, counties, or countries. Little information is available about the factors that lead these groups to go to a particular hospital, live in a particular region, go to a particular doctor, etc. The population base from which each comparison group is derived should, in principle, be quite similar for all groups. Basically, if the groups are drawn from a similar population, unmeasurable and potentially confounding variables are more likely to be equally distributed between groups. In addition, the measurement of practice variations cannot be valid without information on relevant "initial conditions". Initial conditions are all confounding factors and effect modifiers, other than the treatment/practice patterns, that may cause or influence the clinical outcomes of interest. These factors may explain practice variations among groups that do not share similar initial conditions. To evaluate practice patterns-outcomes associations, potential confounders must be identified and controlled for in the analysis. Aside from clinical presentation and severity of illness; the initial conditions to be identified and characterized as completely as possible include physician, patient, and practice environment factors . Measurement of such factors is essential to minimize the chance of a systematic error following confounding biases and effect modification . Figure 1 | Table 1 | Initial conditions to be taken into account when making inferences about practice patterns-outcomes associations Identification and measurement of outcomes of interest | Limitations to the development and evaluation of practice guidelines also include the absence of a clear concept of the targeted outcomes and the paucity of outcomes data to support these guidelines . There appears to be only a weak relationship between the purpose of guidelines and many of the outcomes usually measured in clinical research, that is, the source of evidence for guideline development (evidence-based). The initial goals of establishing practice guidelines -- to reduce costs and enhance the quality and appropriateness of treatment -- are, in fact, rarely the basis for guideline development, since little data is available for these outcomes. To some degree, the development of guidelines has been driven by the availability of data on clinical outcomes, such as morbidity and mortality, rather than those outcomes related to the primary goals of the guidelines. The evaluation of practice guidelines | Throughout the development of practice guidelines, the major deficiency has been the lack of an evaluative method . Thus, we suggest a methodological framework for outcomes research to be applied to evaluate practice guidelines. Outcomes research evaluates practice patterns as they occur in actual clinical settings. This type of research can describe practice patterns, evaluate their divergence from practice guidelines and determine the effect of practice variations on outcomes. Outcomes research is necessarily observational in nature and, although observational studies have been used to evaluate health care interventions, the proposed methodological framework has yet to be applied to outcomes research. Why should outcomes research be used to evaluate and validate practice guidelines? The primary goal of practice guidelines is the consistent adherence by physicians to practice patterns that achieve the "best" outcomes at the lowest cost. Outcomes research evaluates practice patterns as they occur in actual clinical settings, and is thus the logical method to evaluate practice guidelines. In fact, outcomes research and practice guidelines are connected through concepts that relate to efficacy and effectiveness research . Efficacy studies, which normally complement practice guideline development, are those performed in highly selected groups of patients to investigate if a particular intervention works under controlled conditions set by the study investigators. In contrast, outcomes research evaluates practice as it occurs in actual clinical settings . Research in these settings is called effectiveness research because the investigators have limited control over the conditions that qualify the practice settings. The difference between efficacy and effectiveness research can be summarized as follows: does it work at all (efficacy) or does it work in the real world (effectiveness)? Thus, there exists a dynamic process in which evidence from both effectiveness and efficacy studies feeds into the development and evaluation of practice guidelines, as depicted in Figure . Figure 2 | Relationship between outcomes research and practice guidelines Relationship between outcomes research and practice guidelines Most practice guidelines are derived from efficacy studies rather than effectiveness studies. Therefore, it is not surprising that practice guidelines are not fully applicable in actual clinical practice. We suggest that effectiveness studies be used not only as a method to evaluate practice guidelines but also as a basis for their development. These could include both observational studies and effectiveness trials. Outcomes research better reflects practice in the real world and may make guidelines more likely to be applied. However, to date, little attention has been paid to the epidemiological underpinnings of the methods used to conduct outcomes research. Discussion : We will first propose a methodological framework for outcomes research. Then, we will show how it can be used to evaluate practice guidelines. Finally, we will address the limitations of the proposed methodological framework. Generic epidemiological issues in outcomes research | In the proposed methodological framework, the generic issues related to outcomes research will be discussed in sequential order. In outcomes research, the first step is to identify the study population and the groups (hospitals, providers, regions, etc.) that will be compared. The next step is the measurement of practice patterns and outcomes. After groups are compared on the basis of the treatment they receive and outcomes of interest, associations are sought between practice patterns and the various measures of outcome. This step of the methodological framework raises issues of confounding bias because not all factors that can confound these associations are measured and controlled or even known. The presence or absence of confounding bias can be affected by the other sources of bias namely selection and information biases. Lastly, we discuss the issue of temporal trends. In the evaluation of practice guidelines, the measurement of practice patterns may not be contemporaneous with the publication of practice guidelines. This may explain and even lead to the frequently observed discrepancy between the actual practice and what the guidelines state that it should be. Finally, two particularities of outcomes research 1) the presence of ecological exposures in individual level studies and 2) the common use of large administrative databases are discussed. Specification of the model | Definition of the elements of the proposed epidemiological model for outcomes research | In the proposed model for outcomes research designed to evaluate practice guidelines, the outcome of interest can be a disease . For example, if the practice patterns that are being studied pertain to coronary revascularization, complications such as mortality and reinfarction after acute myocardial infarction may constitute the outcome of interest. Finally, the consequences of different practice patterns on medical resources (cost, quality and appropriateness) may be another possible outcome of interest. Table 2 | Epidemiological model for outcomes research to evaluate practice guidelines In the studies of outcome research, practice patterns, (which constitute the exposure in the proposed model), range from the use of medication, diagnostic tests and therapeutic procedures to the length of hospital stay, transfer to other facilities and/or scheduled physicians visits. The primary goal of outcomes research is the evaluation of the effects of the selected practice patterns on the outcomes of interest. Consequently, any inference made about this association must be evaluated as a function of the potential selection, information (measurement error) and confounding biases. A limitation of outcomes research as it is most often performed is the lack of attention given to the measurement of each of the elements of the epidemiological model shown in Table 3. The basis of the proposed methodological framework will be the identification of generic sources of potential bias that relate to each element of the proposed model. Selection bias | Since outcomes research is observational in nature, the choice of the study population and of the compared groups is highly susceptible to selection bias. As applied to outcomes research, selection bias is defined as a distortion in the estimate of the practice patterns outcomes association due to the way that subjects are selected for inclusion in the study population and in the different groups to be compared . A major consequence of selection bias is the potential confounding of inferences made about practice patterns-outcomes associations. This occurs when some characteristics of the subjects related to practice patterns or clinical outcomes influence the selection or exclusion of individual subjects, groups of subjects or practice environments. The selection process should be such that patients included in the study population come from the same target population . Furthermore, patients or study members should have a similar probability of being selected and included in the actual population. Inclusion and exclusion criteria must be clearly defined in order to characterize the actual population as precisely as possible. Judging the internal validity of a study is more feasible when there is a detailed account of how the individuals were selected to become members of the actual population. Finally, the study population, also needs to be carefully characterized so that the inferences derived from the analysis of the study population can be evaluated for both internal validity (based on the data analyzed in the study) and external validity (the extent to which results obtained from the data analyzed in a particular study can be generalized to populations outside of the study). Any systematic differences between those actually studied and the source (target) population could result in biased estimates of the impact of a practice pattern on a clinical outcome. In many studies of outcomes research, groups exposed to different practice patterns are compared. The identification of such groups of patients is sought to assess the impact of different practice patterns on various outcomes in actual clinical settings and, as previously mentioned, can be used to assess practice guidelines. Because of such study design, it becomes unclear as to what the target population precisely is. Is it the group (the set of patients in a given environment) or is it the individuals receiving the various practice patterns within each group? For example, in a study of regional variations in the treatment of acute myocardial infarction in the U.S., the treatment of patients (practice patterns) was compared across different regions of the U.S. In this study, one wishes to generalize the findings about practice patterns-outcomes associations to all individuals with acute myocardial infarction (individual level). One also wishes to generalize the effect of the exposure, which is in this case practice patterns, to those prevalent in a given region (ecological level). The presence of these two levels, the individual and the ecological levels, introduces an added level of complexity in terms of the assessment of the effect of the exposure on outcome. When comparing practice patterns across regions using individual data, there is a certain degree of correlation brought about by the clustering of practice patterns that needs to be taken into account. Such a correlation is very difficult to quantify. In contrast, when assessing the effect of the exposure at the individual level, there are ecological factors (initial conditions particular to a given region) that need to be taken into account. The data originating from studies with mixed design, which are often the design of outcomes research studies, need to be analyzed with special attention to the degree of correlation between the individual covariates and to the presence of ecological exposure variables. Another potential source of selection bias is the choice of the groups to be compared, which depends on the criteria used to divide the groups. Individuals included in the groups to be compared should have the same probability of being included in these groups. Not infrequently in outcomes research, geographic criteria (such as country, regions, hospitals) are used because such criteria allow the identification of clinically comparable groups that receive very different treatments, whose resulting outcomes can then be assessed. However, such a process must be scrutinized for the possibility of selection bias other than the treatments that are being evaluated. Such selection bias would make groups not comparable as to clinical and other factors that could affect outcomes. The presence of a biased selection process could lead to confounding bias when practice patterns-outcomes associations are assessed. Such a situation may occur when the study groups are not comparable with regard to some characteristics of the subjects related to practice patterns or clinical outcomes that influenced the selection or exclusion of individual subjects, groups of subjects or practice environments. For example, in the same study of regional variations in the treatment of acute myocardial infarction, census regions of the U.S. were arbitrarily chosen as a basis for comparison. In this example, patients with similar risk of developing the outcome of interest, which is defined here as a complication after acute myocardial infarction, may not have had the same probability of being included in the different groups to be compared. Confounders may then bias the practice patterns/outcomes association if the selection of different risk groups is related to practice patterns. Selection bias can also affect the assessment of outcomes. Potential sources of this bias include loss to follow-up or missing data. Follow-up data is difficult to obtain in outcomes research studies, which often rely on administrative databases for data acquisition. Linkage, either of different databases or of the same database over time, is often performed . A failure to link the databases for a number of individuals presents a problem equivalent to having data missing for these individuals. Information bias | The second step in outcomes research studies is the measurement of practice patterns and of the outcomes of interest. Here, issues of information bias must be considered. Information bias can be defined as a distortion of the potential practice patterns outcomes association due to misclassification of subjects with regard to practice patterns, outcome measures or both, or due to measurement error . There are two major ways in which practice patterns can be misclassified. They relate to the sensitivity and specificity of the tests that are used for the diagnosis for which practice patterns are being evaluated and for the classification of the outcomes of interest. The measurement of the different practice patterns and their related outcomes largely depend on the identification of a group of patients who have a given diagnosis and require a given treatment. The characteristics that make a diagnosis more amenable to outcomes research are the following: 1) a precise diagnostic definition, 2) a diagnostic test with high sensitivity and specificity, 3) reproducibility among different individuals and locations, 4) easily coded, 5) related to a procedure, and 6) common and costly, so that it is likely to be collected in large, administrative databases frequently used in outcomes research. Because of such requirements, only a limited number of clinical conditions are amenable to outcomes research. Acute myocardial infarction is an example of a diagnosis that can be made with a high level of certainty because it has a precise diagnostic definition and well-defined diagnostic criteria, which, when taken together, have high sensitivity and specificity for the correct classification of patients. Therefore, it is easy to identify a study population that, in fact, has this disease and to describe their treatment. Thus, in order to minimize the misclassification of relevant practice patterns, the methods used to classify the disease and the outcomes that relate to the practice patterns under investigation must have high sensitivity and specificity . Given the principles underlying the measurement of practice patterns and outcomes, how are the measurements generally made in outcomes research studies? The measurement of the exposure (practice patterns) in outcomes research is valid only if it corresponds to the "true" practice as performed in the clinical setting. Again, practice can only be "true" if the diagnosis is correct. The identification of both patients with the disease of interest and their treatment requires a source of information that has the features of a diagnostic test. In outcomes research, administrative databases are often used as an information source to identify a study population and to obtain data on exposure. The database coding of diagnoses and procedures can be used as a "diagnostic test" to identify the clinical condition for which practice patterns will be described and to classify the practice patterns themselves and the outcomes of interest. Such a "diagnostic test" will have higher sensitivity and specificity values for some diagnoses than for others. For example, administrative database coding will have higher sensitivity and specificity for procedure-related diagnoses (such as hip fracture) because the diagnostic code is related to a major operation and is likely to be recorded for administrative purposes. In contrast, a diagnostic criterion for osteoarthritis can be quite vague and administrative coding is likely to have very low sensitivity and specificity for this diagnosis. The use of databases as a diagnostic test must be validated in all outcomes research studies, especially those using administrative databases. Methods to validate these databases include chart reviews, a priori coding systems or both. These validation methods ensure that coding is as accurate and reproducible as possible, thus allowing the database to be used as a diagnostic test to identify the study population and the practice patterns and the outcomes in outcomes research. However, these validation methods are rarely used. Finally, appropriate measures of outcomes that will serve to evaluate practice guidelines must be identified. This presents a problem because most practice guidelines aim to reduce practice variations, which will, in turn, lead to improved appropriateness and quality of care. However, how appropriateness and quality of care are measured is controversial and will not be discussed here . Nevertheless, defining the outcomes that will be used to evaluate practice guidelines is a crucial step in this process. Quality of life and functional status measures constitute another group of outcome measures that should be included for the evaluation of practice guidelines. These dimensions of outcomes have received more attention from health providers, while consumers have become more concerned about outcomes of care. However, these outcomes also are difficult to measure, because they rely heavily on patient interviews and questionnaires. They are likely to vary with patient expectations, culture, and climate and are thus potentially to be measured with error and be misclassified. A few reliable, valid instruments have been developed to assess health-related quality of life , but such instruments are not easily used to collect this information from large databases. There is a need to develop instruments to measure these types of outcomes, whether they are conversion factors for existing databases (such using length of stay as a proxy for cost) or new measures that could easily be integrated in administrative databases. Such measures could include estimates of functional class or severity of illness. At present, many outcomes research studies measure mortality and disease-specific morbidity. The validity of the measurement of these outcomes is limited by the type of database that is used. For example, using death registries to obtain causes for death is a notoriously invalid source for this type of information. There are many examples of poor correlation between cause of death as established by death registries versus disease registries. Death certificates in New York City during 1992 were assessed to determine the accuracy and frequency of reporting tuberculosis as a cause of death. Of 310 persons who died with active tuberculosis in 1992 (based on a disease-specific registry), only 34% had tuberculosis listed on their death certificate. Thus, in this example, as in many others like it, using death certificates led to an inaccurate measure of disease burden . Confounding bias | In outcomes research terms, confounding bias is present when the effect of the practice variations on the outcomes of interest is distorted because of the effects of extraneous variables (variables that are causally associated with the practice variations and the outcomes of interest) . This issue is crucial in outcomes research because, while outcomes research shares the purpose of a clinical trial (to evaluate different treatments), it primarily uses observational methods -- investigators conducting outcomes research have limited control over potentially confounding factors (the initial conditions of individual groups of patients). Because outcomes research builds on existing practice variations and analyses the natural ongoing experiment, there is ample opportunity for confounding bias to invalidate any inference made about practice patterns outcome associations . For example, variations in practice patterns could reflect variation not only in the use of a given procedure but also in the severity of disease. Assignment of patients to certain procedures on the basis of the severity of illness makes sense clinically, but in outcomes research, it is a common and important source of confounding if the procedure is either efficacious or particularly harmful in high-risk patients. Many indices have been developed to measure the severity of illness when using existing databases to correct for such confounding, but one can never be sure that this type of confounding has been entirely controlled . This presents an intrinsic limitation of outcomes research. Avoidance of confounding bias is limited by the source of data used to describe practice patterns, particularly when observational data, such as the large Medicare administrative databases, are used to compare outcomes among patients who receive different treatments. The potential for confounding bias arises because many factors other than the treatment under evaluation may affect patient outcomes. These factors include comorbid diseases, severity of illness, and patient, physician and environmental factors. Such factors are likely to influence treatment decisions but are difficult to capture fully in recorded data. Researchers cannot adjust for imbalances in prognostic factors that are unmeasured or poorly categorized and administrative data, in particular, may lack the precise and accurate coverage of clinical details needed to permit full and fair adjustments. Further data collection might solve this issue, but it is not always possible to collect additional information. Standard statistical modeling can attempt to adjust for the known differences between the groups, but this might not be sufficient for unmeasured differences. Several alternative methods have been suggested. One method is subgroup analysis to adjust for unmeasured differences between groups of individuals who differ on known risk factors. Another method consists of the use of instrumental variables . Instrumental variables are observable factors that influence treatments but do not directly affect patient outcomes. This approach uses the so-called instrumental variables to mimic a randomization of patients to different likelihoods of receiving alternative treatments. McClellan et al. applied this methodology to assess whether more aggressive use of invasive cardiac procedures improved outcomes in the elderly. In this study, the instrumental variable was the distance of the patient's residence from the nearest hospital with on-site angiography. The authors noted lower mortality among elderly individuals who received more aggressive treatment than among those treated more conservatively. Temporal trend bias | We propose a bias called a "temporal trend bias" that is particular to the use of outcomes research to evaluate practice guidelines. This bias results from the inability to control for secular trends. It reflects the fact that by the time practice guidelines are published and disseminated, new treatments and technology are being incorporated into clinical practice. Thus, it is difficult to identify a pure application of a practice guideline whose application is not undermined by recent advances in medicine and technology. For example, we evaluated the effect of a specific set of guidelines on return to work after acute myocardial infarction. The use of these guidelines had been successful in a university setting; this study assessed their use in a community setting. During the 5 years that elapsed between these two studies, practices changed. The use of guidelines was less successful in the community not only because they did not influence practice but also because usual care had grown closer to the proposed guidelines . Ecological exposure in individual level studies | A frequently encountered particularity of outcomes research study design is the presence of both ecological exposure and individual level covariates in the same analysis. Because the unit of analysis is a group, but inferences are made about the impact of a given practice pattern on individual outcomes, many outcomes research analyses have elements of both individual and ecological analyses . In our study of regional variations in the treatment of acute myocardial infarction, measures describing practice patterns at the regional level, ecological exposure, (proportion of patients receiving angiography, angioplasty, and coronary artery bypass surgery) were linked to the outcome measures of mortality adjusting for individual level variables that measured severity of disease. Then, inferences were made about the use of these procedures at the patient level. Although the unit of analysis is the region, which would demand an ecological analysis, there are individual level covariates, which are likely to be correlated within each region, that need to be taken into account. When group measures are used that contain individual-level variability with some degree of correlatedness (within region) and aggregate-level variability (between regions), specific analytic tools must be used. It has been suggested that hierarchical logistic regression modeling be used to examine the interplay between sources of variation in the use of health-care services, that is, between ecological-level and individual-level sources. This type of modeling is designed to separate true variability across areas from observed variability. An application of this method is the work by Gatsonis et al. who found that practice variations across regions of the U.S. in the use of angiography after acute myocardial infarction were largely explained by differences in patient characteristics and geographic region. However, states that had more on-site availability of angiography still tended to have higher angiography rates after accounting for between-region and within-region variability. After analysis for sources of variability, more reliable inferences about the associations between practice patterns and outcomes can be made. Sources of data | The application of the proposed methodological framework for outcomes research largely depends on the sources of data that are used to evaluate the effect of the practice variations on outcomes . Most commonly, the study design is a retrospective cohort analysis and the dataset that is used has been obtained either for administrative purposes (discharge databases) or for a randomized clinical trial that addressed a different question . Less often, a prospective cohort study is designed to evaluate a particular set of practice guidelines . Although a prospective design provides more control in data collection than a retrospective analysis, both designs are subject to selection, information and confounding biases. The ideal database to use for the evaluation of practice guidelines is one that allows the precise measurement of the practice patterns (exposure) and outcomes (disease) as well as the measurement of potential confounders (severity of illness, precision of diagnosis, socioeconomic characteristics). Unfortunately, such a database probably does not exist. The strength of administrative databases, such as that of Medicare is that they allow the observation of large numbers of patients for which practice patterns can be evaluated as they occur in actual clinical practice. Furthermore, administrative databases allow the observation of practice patterns outcomes associations in large numbers of unselected patients. However, the limitations of such databases include the missing information about potential confounding factors, such as severity of illness, and the limited ability to measure exposure and outcome accurately. Many databases that are not designed for clinical research either mismeasure patient outcomes or fail to capture outcomes that are important to both physicians and patients (such as quality of life and functional status). The control of these biases was the basis of the methodological framework for outcomes research proposed in this chapter. The application of outcomes research methods to practice guideline evaluation | The application of outcomes research methods to practice guideline evaluation can accomplish several goals. One important goal is the evaluation of practice guidelines, that is, to determine to what extent the guidelines accomplished their primary goals after their dissemination. We have suggested the model of chronic disease epidemiology as the methodological framework for outcomes research to evaluate practice guidelines. The steps to evaluate practice guidelines using outcomes research when the basic design is a retrospective cohort study are summarized in Figure Some limitations to the application of this model exist. The reasons for the inability of the proposed methodological framework to deal completely with the intrinsic biases in outcomes research are listed in Figure . They relate mostly to the databases usually used in studies of outcomes research. Figure 3 | Steps to evaluate practice guidelines using outcomes research Steps to evaluate practice guidelines using outcomes research Figure 4 | Reasons for the inability of the proposed methodological framework to deal with biases in outcomes research Reasons for the inability of the proposed methodological framework to deal with biases in outcomes research Summary : The proposed methodological framework for outcomes research to evaluate practice guidelines reflects the selection, information and confounding biases inherent in its observational nature which must be accounted for in both the design and the analysis phases of any outcomes research study. Indeed, a major limitation of outcomes research is the inability to account for unobserved heterogeneity that directly correlates with practice patterns and/or health outcomes. This may lend bias to any inferences made about practice variations and outcomes. "Researchers cannot correct for the subtle reason doctors choose one treatment over another for a particular patient. That bias, in turn, can undermine the entire premise of outcomes research" . These are intrinsic properties of outcomes research that can be dealt with only in part, by applying the principles of chronic disease epidemiology. Thus, this proposed methodology can serve as a framework for the conduct of outcomes research in the evaluation of practice guidelines but its application will be limited. Competing interests : none declared Pre-publication history : The pre-publication history for this paper can be accessed here: Backmatter: PMID- 11914162 TI - Organization specific predictors of job satisfaction: findings from a Canadian multi-site quality of work life cross-sectional survey AB - Abstract | Background | Organizational features can affect how staff view their quality of work life. Determining staff perceptions about quality of work life is an important consideration for employers interested in improving employee job satisfaction. The purpose of this study was to identify organization specific predictors of job satisfaction within a health care system that consisted of six independent health care organizations. Methods | 5,486 full, part and causal time (non-physician) staff on active payroll within six organizations (2 community hospitals, 1 community hospital/long-term care facility, 1 long-term care facility, 1 tertiary care/community health centre, and 1 visiting nursing agency) located in five communities in Central West Ontario, Canada were asked to complete a 65-item quality of work life survey. The self-administered questionnaires collected staff perceptions of: co-worker and supervisor support; teamwork and communication; job demands and decision authority; organization characteristics; patient/resident care; compensation and benefits; staff training and development; and impressions of the organization. Socio-demographic data were also collected. Results | Depending on the organization, between 15 and 30 (of the 40 potential predictor) variables were found to be statistically associated with job satisfaction (univariate analyses). Logistic regression analyses identified the best predictors of job satisfaction and these are presented for each of the six organizations and for all organizations combined. Conclusions | The findings indicate that job satisfaction is a multidimensional construct and although there appear to be some commonalities across organizations, some predictors of job satisfaction appear to be organization and context specific. Keywords: Background : There appears to be no one commonly accepted definition for quality of work life. In healthcare organizations, quality of work life (QWL) has been described as referring to the strengths and weaknesses in the total work environment . Characteristics that describe the overall organization are viewed as part of the behaviour and reward system of the staff working in that setting. Organizational features such as policies and procedures, leadership style, operations, and general contextual factors of the setting, all have a profound effect on how staff view the quality of their work life. QWL is an umbrella term which includes many concepts. Therefore, concentrating on only one job characteristic, whether it is wages or management style, is an inadequate approach to assessing QWL. Because the perceptions held by employees play an important role in their decisions to enter, stay with or leave an organization, it is important that staff perceptions be included when assessing QWL. And although job satisfaction is not QWL, perception of QWL is often assessed using job satisfaction surveys. Previous studies have shown that low job satisfaction is a major cause of turnover among health care providers . In addition, job satisfaction may affect the quality of service and organizational commitment and may be a contributing factor associated with shortages of health care providers . Such findings have recently increased interest in studying job satisfaction among health care providers . The results of a 1993 meta-analysis of 48 studies looking at work satisfaction in over 15,000 nurses revealed that job satisfaction was associated strongly with reduced work stress, organizational commitment, communication with supervisors, autonomy, employee recognition, fairness, locus of control, years of experience, education, and professionalism. This study also found a strong relationship between job satisfaction and QWL for nurses . After reviewing the literature on QWL and job satisfaction, and considering the wide variety of health care settings, situational contexts, and organizational structures (including management styles, reporting structures, staffing complements, and levels of training and experience) in which employees work, we hypothesized that the predictors of job satisfaction would vary depending on the organization. The purpose of this study was to identify organization specific predictors of job satisfaction within a health care system that consisted of six independent and distinct organizations located in five communities in Central West Ontario, Canada. Methods : Setting | The settings for this study included six independent and distinct health care organizations providing varying levels and types of care. All six organizations were affiliated with the St. Joseph's Health System (SJHS) located in five Central West Ontario communities. Collectively, the SJHS is one of the largest corporations in Canada devoted to health care. At the time of the study (2000), the SJHS employed 5,486 full, part and casual time (non physician) staff. Additional information about of each of the six organizations and their respective communities is provided in Table . Table 1 | Characteristics of the Organizations within the St. Joseph's Health System. Questionnaire development | Items included in the "Quality of Work Life Survey 2000" were selected after a review of the literature and extensive consultation between research team members and the QWL Task Force (a management group consisting of representatives from each of the six SJHS organizations). The initial selection of items was influenced by a recently published Canadian study and reports from two meta-analyses . The QWL Task Force then refined these items to consider, among other things, issues of accuracy, relevance, readability, grammar, potential for offensiveness, and appearance of cultural or gender bias. After several months of development, the instrument was pretested on a small group of staff at two of the participating organizations (Site 2 and Site 4 -- see Table ). This pretesting was done to ensure that individuals could follow the instructions associated with the format, to obtain estimates of the time required to complete the survey instrument, to identify items that were poorly written or ambiguous, and to identify an appropriate implementation strategy. The questionnaire and implementation strategies were revised accordingly. The final 65-item survey contained nine sections representing topic areas considered relevant to assessing QWL in the SJHS. Eight scale scores were developed from the individual items (see below and : Statistically Significant Organization Specific (Univariate) Predictors of Job Satisfaction). The Co-worker and supervisor support section included 10 closed-ended and 1 open-ended questions. A 3-item supervisor social support scale included questions about supervisor helpfulness, concern about the welfare of employees, and ability to facilitate effective interaction among employees. Co-worker support was measured by a 7-item scale reflecting the extent to which co-workers were seen as competent, understanding, and supportive of employees. Both scales where adapted from Woodward et al. (1999) . The Teamwork and Communication section included 9 closed-ended and 1 open-ended questions. For determining teamwork, a 7-item scale was adapted from Taylor and Bowers (1972) to measure the extent to which one's work unit coordinates efforts, solves problems and works together effectively . A 2-item scale developed for this project measured how communication was practiced within the organization. The Job Demands and Decision Authority section included 15 closed-ended and 1 open-ended questions. It included a 4-item scale adapted from Brosnan and Johnson (1980) to measure clarity regarding responsibilities, workloads and conflicting demands . There was also a 9-item scale adapted from Karasek et al. (1998) to measure the extent to which respondents' jobs gave them autonomy or decision-making latitude , and 2 questions which reflected the demands of one's work . The Characteristics of Your Organization section included 6 closed-ended and 1 open-ended questions. This section was adapted from Woodward et al. (1999) and included a 4-item scale that inquired about the extent to which the organization encouraged the best efforts from staff, and how employees were treated . Two additional questions examined the extent to which staff were kept informed, and organizational recognition of employee contributions. The Patient/Resident Care section included 5 closed-ended and 1 open-ended questions. The questions (developed for this project) were used to measure employees' perceptions of the quality and timeliness of care provided for patients and residents at their respective organizations. The Compensation and Benefits section included 10 closed-ended and 1 open-ended questions. These questions were developed for this project to determine employee satisfaction concerning a number of employee benefits and level of pay. The Staff Training and Development section included 6 closed-ended and 1 open-ended questions. These questions (developed for this project) measured the extent to which each organization supports its staff in training, educational development and opportunities for advancement. The Overall Impressions of Your Organization section included 4 closed-ended and 4 open-ended questions. All of the questions (developed for this project) assessed staffs' impressions of and overall satisfaction with their organization. The question "Overall, how satisfied are you with your job?" was used as the outcome variable in this study. The Staff Socio-Demographic Information section included 10 closed-ended questions (developed for this project) to collect information on gender, age, marital status, education, length of employment, supervisory status, time spent on job activities, job status and job classification. Within each of the first 8 sections, employees were asked to circle the response that best described their feelings using 5-point Likert scales. Employees were also asked for written comments pertaining to each of the sections and were provided space to comment on other issues they felt were important. Survey Procedure | Because of the diversity of organizations and staff within the SJHS, it was decided by the QWL Task Force, organization administrators and researchers that the implementation of the survey would be customized to best fit each of the organizations. It was felt that a varied approach would be more feasible for the organizations and that this would help maximize response rates. Although the procedures were not identical, all of the organizations provided as a minimum: advance notification (written or voice mail) of the survey to all staff (eligibility was based on whether the worker was active on the organization's pay roll at the time of the study and was not a physician); access to questionnaires for all staff (the QWL Task Force felt that each staff member in the SJHS should have the opportunity to complete a questionnaire); one or more reminder notices (e.g., letters, newsletters, voice mail, personal communication); and sealed drop off boxes for completed questionnaires. Pilot testing of the questionnaire revealed that employees felt that tracking individual employees for the purpose of follow-up (i.e., to increase response rate), violated the perception of anonymity and confidentiality. Therefore, to help ensure anonymity and confidentiality, follow-up attempts were limited to general reminder notices to all staff. Analysis | All closed-ended (or quantitative) responses were entered directly from the questionnaires into SPSS (version 10.0.5 for Windows, SPSS, Inc., Chicago, 1999). Prior to data analysis, most of the survey questions were re-coded. Questions which asked participants to select one response within a five point scale (never to always; very dissatisfied to very satisfied; very poor to very good; no, definitely not to yes, definitely) were collapsed into two categories. For example, for the response scale (1=very dissatisfied, 2=dissatisfied, 3=not sure, 4=satisfied, 5=very satisfied) those who indicated they were either satisfied or very satisfied were re-coded as "satisfied" while all others were re-coded "not satisfied" by default. In several instances, it was appropriate to combine two or more of the questions into a composite scale score. See "Questionnaire Development" section and : Statistically Significant Organization Specific (Univariate) Predictors of Job Satisfaction for additional details on how the composite scale scores were calculated. In total, there were eight scale scores (supervisor social support; co-worker support; teamwork; communication; role clarity; decision latitude; organization/staff relations; patient/resident care). Scale scores were generated by summing the participant responses (i.e. one to five) for all questions that made up the scale. In the rare situation where a participant failed to answer one or more of the questions that made up a scale score, missing values were replaced with mean values for that organization. Scale scores were categorized into meaningful dichotomous categories prior to analysis (e.g., satisfied or not satisfied). For the purpose of this study, QWL was operationally defined using the global question "Overall, how satisfied are you with your job?". Employees rated job satisfaction from very dissatisfied to very satisfied using a five point scale (very dissatisfied, dissatisfied, not sure, satisfied, very satisfied). For the analysis, however, those indicating they were either satisfied or very satisfied were considered to be "satisfied" with their jobs. All others were considered "not satisfied" with their jobs. Prior to analysis, study researchers reached a consensus on which survey questions to include as potential predictors of job satisfaction. In total, there were eight scale scores and 32 questions that were rationalized a priori as potential predictors of job satisfaction. Data from each of the organizations, as well as all of the organizations combined (representing the SJHS), were analyzed separately to identify predictors of job satisfaction. T-test, chi-square analyses and, when appropriate, Fisher exact tests were used to determine which of the variables were statistically associated with job satisfaction i.e., were potential predictors of job satisfaction. Descriptive information (numbers and percentages) for each of the variables was calculated by whether or not staff were satisfied with their jobs. In addition, p-values, odds ratios, and 95% confidence intervals for the odds ratios were calculated for each potential predictor of job satisfaction. Separate logistic regression analyses were used to identify the best predictors of job satisfaction for each organization and for all organizations combined (SJHS). Only variables which had a statistically significant association with job satisfaction were included in these analyses. Adjusted odds ratios and corresponding 95% confidence intervals are reported for each organization and the SJHS. The logistic regression analyses produces odds ratios which have been simultaneously adjusted for all other variables in their respective final models. The goodness of fit of the logistic regression models were assessed using the rho-squared statistic . A rho-square value between 0.20 and 0.40 suggests a very good fit of the model. A probability level of <0.05 was used to determine statistical significance. SPSS and Epi-Info (version 6.04a, Centers for Disease Control and Prevention, Atlanta, 1995) were used for statistical computations. Results : Table provides additional information about each of the six health care organizations, including the type of organization, number of staff, number of beds or visits/year, and the size of the community where the organization was located. Respondent participation rate | Response rates are often used as an indicator of the representativeness of a sample of respondents. Of the combined 5,486 staff, 1,819 (33.2%) returned a completed questionnaire. Organization specific response rates varied from 25.3% to 55.3% . In an attempt to assess the representativeness of respondents, a comparison was made of available socio-demographic information between respondents and all staff within each of the organizations. Overall, female employees were more likely to respond than male employees (it should be noted, however, that the vast majority of staff (82% to 98%), were females within each of these organizations), as were full-time employees compared to part-time, casual or temporary employees. There were also some differences in respondents, across organizations, based on job classification. All organizations, however, had respondents within each job classification. A statistical estimating procedure was also used to assess how accurately respondents represent staff at each of the organizations . This calculation suggests that the organization specific findings were accurate plus or minus 3.6% to 8.8%, 19 times out of 20 . Table 2 | Response rates and accuracy of responses by organization. Potential predictors of job satisfaction | Organization specific and combined SJHS (univariate) analyses (t-test, chi-square analyses and, when appropriate, Fisher exact tests) were used to determine which of the potential predictor variables were statistically associated with job satisfaction. Included in these analyses were the 40 potential predictor variables (8 scale scores and 32 individual questions). See : Statistically Significant Organization Specific (Univariate) Predictors of Job Satisfaction for a list of all variables. The number of statistically significant variables ranged from 15 to 30 depending on the organization and 32 for all organizations (SJHS) combined (see : Statistically Significant Organization Specific (Univariate) Predictors of Job Satisfaction). Best predictors of job satisfaction | Separate logistic regression analyses were then used to identify the best predictors of job satisfaction for each organization and for all organizations combined (SJHS). All variables found to be statistically associated with job satisfaction from the univariate analyses were entered into these logistic regressions analyses. The best predictors of job satisfaction are presented in Table . The ranking assigned to these variables relates to the order in which variables were added to the logistic regression models. For example, the rank "1" refers to the first variable that was added to the model i.e., the variable which best improved the fit of the model (or the most important variable). A more detailed description of the magnitude (as represented by the size of the odds ratios) and statistical significance (as represented by the 95% confidence intervals of the odds ratios) of the association between each of these predictors and job satisfaction is presented below for each organization and all organizations combined (SJHS). The best predictors of job satisfaction are again ranked according to their importance. All of the odds ratios presented below have been simultaneously adjusted for all other variables in their respective final logistic regression models. All logistic regression models achieved a rho-square between 0.20 and 0.40 suggesting they were very good (fitting) models for predicting job satisfaction. Table 3 | Best Predictors of Job Satisfaction1 Ranked by Organization2. Site 1 (community hospital) | The most important predictors of job satisfaction were: 1) being satisfied with the organization's recognition of employee contributions (OR 5.01, 95% CI 1.59 to 15.81), 2) good decision authority (OR 7.91, 95% CI 1.46 to 42.92), 3) being satisfied with patient resident care (OR 4.66, 95% CI 1.36 to 15.97), and 4) good role clarity (OR 4.24, 95% CI 1.16 to 15.49). The final model achieved a rho-square of 0.30. Site 2 (community hospital/long-term care facility) | The most important predictors of job satisfaction were: 1) good open communication between staff (OR 2.55, 95% CI 1.03 to 6.35), 2) good supervisor social support (OR 6.27, 95% CI 1.36 to 29.00), 3) organization keeps staff informed (OR 3.73, 95% CI 1.51 to 9.20), 4) good decision authority (OR 3.49, 95% CI 1.25 to 9.73), and 5) being satisfied with pay level (OR 2.47, 95% CI 1.14 to 5.34). The final model achieved a rho-square of 0.24. Site 3 (visiting nurse organization) | The most important predictors of job satisfaction were: 1) less frequently (never/seldom/sometimes) asked to do an excessive amount of work (OR 7.22, 95% CI 2.22 to 23.46), 2) being satisfied or very satisfied that the organization keeps employees informed (OR 4.52, 95% CI 1.43 to 14.32), 3) belief the organization carries out its Mission statement (OR 11.17, 95% CI 2.04 to 61.14, and 4) good decision authority (OR 5.29, 95% CI 1.32, to 21.22). The final model achieved a rho-square of 0.34. Site 4 (long-term care facility) | The most important predictors of job satisfaction were: 1) belief the organization carries out its Mission statement (OR 4.63, 95% CI 1.77 to 12.51), 2) good supervisor social support (OR 3.32, 95% CI 1.22 to 9.04), 3) good decision latitude (OR 11.61, 95% CI 1.33 to 101.8), 4) often or always given enough time to get the job done (OR 3.05, 95% CI 1.00 to 9.35), and 5) spending 38 hours or more on the job or job related activities (OR 3.55, 95% CI 1.32 to 9.59). The final model achieved a rho-square of 0.34. Site 5 (community hospital) | The most important predictors of job satisfaction were: 1) belief the organization carries out its Mission statement (OR 3.42, 95% CI 1.82 to 6.43), 2) satisfied that the organization keeps staff informed (OR 2.62, 95% CI 1.48 to 4.65), 3) not being asked frequently to do an excessive amount of work (OR 2.41, 95% CI 1.36 to 4.27), 4) good decision latitude (OR 5.65, 95% CI 2.09 to 15.25), 5) being satisfied with pay level (OR 2.41, 95% CI 1.37 to 4.23), 6) being female (OR 2.99, 95% CI 1.29 to 6.90), and 7) good role clarity (OR 2.45, 95% CI 1.02 to 5.86). The final model achieved a rho-square of 0.25. Site 6 (tertiary care hospital/community health centre) | The most important predictors of job satisfaction were: 1) belief the organization carries out its Mission statement (OR 3.99, 95% CI 2.52 to 6.31), 2) good communication (OR 3.00, 95% CI 1.85 to 4.88), 3) being given enough time to get the job done (OR 2.63, 95% CI 1.58 to 4.40), 4) being a member of the nursing staff (OR 2.73, 95% CI 1.75 to 4.26), 5) good organization support for training and development (OR 3.51, 95% CI 1.59 to 7.76), 6) good decision latitude (OR 2.57, 95% CI 1.30 to 5.09) and 7) being satisfied with the organization's recognition of employee contributions (OR 2.05, 95% CI 1.07 to 3.91). The final model achieved a rho-square of 0.25. All sites combined (SJHS) | The most important predictors of job satisfaction after adjusting for site were: 1) belief the organization carries out its Mission statement (OR 2.79, 95% CI 2.07 to 3.77), 2) good communication (OR 1.87, 95% CI 1.33 to 2.62), 3) less frequently being asked to do an excessive amount of work (OR, 1.80, 95% CI 1.33 to 2.43), 4) good decision latitude (OR 3.28, 95% CI 2.09 to 5.17), 5) being satisfied with pay level (OR 1.61, 95% CI 1.21 to 2.15), 6) being satisfied with the organization's recognition of employee contributions (OR 1.57, 95% CI 1.07 to 2.29), 7) being female (OR 2.83, 95% CI 1.81 to 4.42), 8) good role clarity (OR 1.73, 95% CI 1.17 to 2.56), 9) being satisfied that the organization keeps employees informed (OR 1.35, 95% CI 1.00 to 1.85), 10) good teamwork (OR 1.45, 95% CI 1.01 to 2.09), 11) being given enough time to get the job done (OR 1.57, 95% CI 1.10 to 2.23), and 12) good organization/staff relations (OR 2.02, 95% CI 1.13 to 3.62). The final model achieved a rho-square of 0.26. Discussion : The results of this survey were intended to assist decision-makers in identifying key workplace issues, as perceived by employees, in order to develop strategies to address and improve the quality of working conditions for staff within each of the individual health care organizations and the SJHS as a whole. This research represents the first step of an ongoing process to ensure better QWL for employees. In addition to the findings presented here, information from the survey's open-ended written comments have also been summarized for each of the six organizations (L Lohfeld, K Brazil, P Krueger, G Edward, D Lewis, E Tjam, E., personal communication, 2001) and the SJHS as a whole (St. Joseph's Health System Quality of Work Life Technical Reports 2000). This open-ended information provides additional and complementary information to that which is provided in this report. Together, these findings are currently being used by decision-makers at each of the organizations, and the SJHS, in an effort to improve employee QWL. It should be noted that at the time of this survey, all of the hospitals included in this study (as well all other hospitals within the Province of Ontario) were operating in an environment of restructuring and change. This was a time of anxiety for many health care professionals, hospital staff and the general public. In 1996, the Ontario government created a Health Services Restructuring Commission (HSRC) with a four year mandate to restructure Ontario's hospitals and health services system. The HSRC was given authority under the Public Hospitals Act and The Ministry of Health Act to direct public hospitals to change their roles, transfer services and programs, amalgamate or close. The HSRC completed its mandate, announced its decisions and was terminated in March 2000. The timing for this study was after the decisions of the HSRC were announced. All of the organizations included in this study were impacted to varying degrees either directly or indirectly the HSRC decisions. The most notable impacts occurred at Site 1 and Site 2. Site 1 (a community hospital) was ordered closed effective March 2001 with programs and services to be transferred to the other local community hospital while site 2 (a community hospital/long-term care facility) was ordered to transfer its acute care services to the other local hospital in its community thereby becoming a long-term care facility. During the time of the survey, a new building (adjacent to the current facility) for the new long-term care facility was under construction and was scheduled to open in 2002. These contextual issues could have influenced employee responses and therefore the predictors of job satisfaction for all of these organizations, particularly for site 1 and site 2. There are several positive attributes of this study. First, to our knowledge, it is the largest QWL investigation of health care workers in Canada with 1,819 completed interviews. Second, it is also unique in that we collected information from staff at six distinct and functionally diverse health care organizations. Third, because we could not find an "off-the-shelf" QWL instrument that suited our needs and collected all the information desired by key stakeholders, we developed (through a combination of modifying existing instruments and creating our own questions and scales) our own questionnaire. Finally, although the response rates were not as high as we would have hoped, the findings: appear to be consistent with what we expected a priori (the study's investigators had offices within 5 of the 6 organizations thus having inside knowledge about these organizations); appear consistent with the published literature; and were judged credible by management and staff at each of the sites. The statistical estimating procedure to assess how accurately respondents represent staff at each of the organizations also suggest that our findings were fairly representative of staff within these organizations, particularly the larger organizations. Conclusions : The results of this research show that job satisfaction is a multidimensional construct and is a product of the global evaluation of one's work place and context. This report provides valuable information about how employees in specific health care settings view their work environment. A number of organization specific predictors of job satisfaction were identified as a result of this study. The implications of these findings are currently being deliberated as they relate to improving QWL within each of the six health care organizations that make up the SJHS. These findings, may also be of relevance and value to employees, researchers, evaluators, human resource planners and administrators of similar health care organizations. The results of this survey can also be used as baseline measures against which the findings of future job satisfaction surveys can be compared. Such comparisons place this type of research within a continuous quality improvement framework. Competing interests : None declared. Pre-publication history : The pre-publication history for this paper can be accessed here: Backmatter: PMID- 12022922 TI - Identification of protein tyrosine phosphatase 1B and casein as substrates for 124-v-Mos AB - Abstract | Background | The mos proto-oncogene encodes a cytoplasmic serine/threonine-specific protein kinase with crucial function during meiotic cell division in vertebrates. Based on oncogenic amino acid substitutions the viral derivative, 124-v-Mos, displays constitutive protein kinase activity and functions independent of unknown upstream effectors of mos protein kinase. We have utilized this property of 124-v-Mos and screened for novel mos substrates in immunocomplex kinase assays in vitro. Results | We generated recombinant 124-v-Mos using the baculovirus expression system in Spodoptera frugiperda cells and demonstrated constitutive kinase activity by the ability of 124-v-Mos to auto-phosphorylate and to phosphorylate vimentin, a known substrate of c-Mos. Using this approach we analyzed a panel of acidic and basic substrates in immunocomplex protein kinase assays and identified novel in vitro substrates for 124-v-Mos, the protein tyrosine phosphatase 1B (PTP1B), alpha-casein and beta-casein. We controlled mos-specific phosphorylation of PTP1B and casein in comparative assays using a synthetic kinase-inactive 124-v-Mos mutant and further, tryptic digests of mos-phosphorylated beta-casein identified a phosphopeptide specifically targeted by wild-type 124-v-Mos. Two-dimensional phosphoamino acid analyses showed that 124-v-mos targets serine and threonine residues for phosphorylation in casein at a 1:1 ratio but auto-phosphorylation occurs predominantly on serine residues. Conclusion | The mos substrates identified in this study represent a basis to approach the identification of the mos-consensus phosphorylation motif, important for the development of specific inhibitors of the Mos protein kinase. Keywords: Background : Mos belongs to a small family of cytoplasmic protein serine/threonine kinases having oncogenic activity . It is highly expressed in germ cells but barely detectable in a variety of somatic tissues . Studies in Xenopus oocytes have established a role for c-mos in a) initiation of the maturation process and the meiosis I / meiosis II transition and b) in metaphase II arrest in mature oocytes . In mouse c-Mos is apparently not required for initiation of maturation, however, like in Xenopus it is absolutely essential for the metaphase II arrest . The 124-v-mos oncogene represents one of several transforming gene isolates of the moloney murine sarcoma virus and shows unique constitutive protein kinase activity and enhanced transforming activity when compared to other v-Mos proteins or to c-Mos [,-]. The transforming mechanism of Mos involves signalling through the MAP kinase pathway as phosphorylation of MEK by c-Mos has been demonstrated and mapping analyses have shown that Mos and Raf phosphorylate identical sites on MEK . The upstream events of the Mos/MEK/MAPK signalling cascade have not as yet been identified. In earlier studies we have shown that an activating mechanism of c-Mos is likely to involve a conformational change which is mimicked when a single amino acid is exchanged in the alpha-helix C loop of the kinase domain (Arg145-Gly) resulting in constitutive active c-Mos . Recently Fisher and co-workers proposed an activating mechanism of c-Mos by sequential association with Hsp70 and Hsp90, in addition to phosphorylation . Presence of the activating Arg145-Gly amino acid substitution in 124-v-Mos does not change kinase specificity but is sufficient for constitutive kinase activity . Hence the kinase activity of 124-v-Mos is independent of upstream effectors and we have used this oncogenic Mos derivative to identify substrates for the Mos protein kinase in vitro. Using the baculo virus expression system we have expressed active 124-v-Mos protein kinase, as demonstrated by its ability to auto-phosphorylate, predominantly on serine residues, and to phosphorylate vimentin in vitro. We have analysed a panel of acidic and basic substrates in immunocomplex protein kinase assays and identified two novel in vitro substrates for 124-v-Mos, the protein tyrosine phosphatase 1B and alpha/beta-casein. Results : Three tryptic 124-v-Mos peptides include target sites for auto-phosphorylation | We have expressed 124-v-Mos with the baculovirus system in Sf9 insect cells and immunopurified 124-v-Mos using the anti-Mos N13 antiserum . As a control, a Mos-unrelated protein, a synthetic kinase-inactive construct of PKC, PKCgammaK380R, was expressed in Sf9 cells. Mos kinase assays, completed in the presence of [gamma-32P]ATP, were resolved using SDS-PAGE and the Coomassie blue staining of the protein gel showed visible amounts of immunopurified 124-v-Mos (fig. , arrowhead). The corresponding autoradiograph in figure demonstrates that 124-v-Mos is expressed as a constitutive active protein kinase indicated by its ability to auto-phosphorylate in vitro. Further, a parallel kinase reaction was used for phosphoamino acid analyses which confirmed that 124-v-Mos auto-phosphorylation occurred predominantly on serine residues (fig. ) and a two-dimensional resolution of a tryptic digest of auto-phosphorylated 124-v-Mos showed that three tryptic peptides include auto-phosphorylation target sites (fig. ), demonstrating that auto-phosphorylation occurs on multiple sites of the Mos protein . Figure 1 | Constitutive kinase activity of immunopurified 124-v-Mos from baculovirus expressing Sf9 insect cells. Constitutive kinase activity of immunopurified 124-v-Mos from baculovirus expressing Sf9 insect cells. Auto-phosphorylation of immunopurified 124-v-Mos expressed in Sf9 cells is shown in B (Coomassie stained 10% SDS-PAGE) and A (corresponding autoradiograph). Parallel 124-v-Mos kinase assays were subjected to a two-dimensional phosphoamino acid analysis (C) or a tryptic digestion followed by a two-dimensional resolution (D). Arrowheads indicate the origin of sample application in (C,D) and the position of 124-v-Mos (A,B). 124-v-Mos phosphorylates vimentin but not tubulin in vitro | Initially, we tested the kinase activity of 124-v-Mos using previously identified Mos substrates. It has been shown that 124-v-Mos, derived from mos-transformed fibroblasts, phosphorylates vimentin in vitro and as presented here in figure , in vitro kinase assays using immunopurified 124-v-mos from Sf9 insect cells showed strong vimentin phosphorylation. In contrast, tubulin which has been shown to be phosphorylated in vivo and in vitro by Xenopus c-Mos was not a substrate for 124-v-Mos in vitro (fig. ). We have tested tubulin purified from various organs (mouse brain, testis and spleen) either polymerised, unpolymerised or pretreated with phosphatases but in none of these states found tubulin to be phosphorylated by 124-v-Mos (data not shown). Figure 2 | 124-v-Mos phosphorylates vimentin but not tubulin. 124-v-Mos phosphorylates vimentin but not tubulin. In vitro 124-v-Mos kinase assays with either vimentin (C,D) or purified tubulin from brain (A,B) as substrates were electrophoresed using 10% SDS-PAGE and Coomassie stained (B,D), the corresponding autoradiographs are shown in (A,C). Immunoprecipitates of Sf9 cells expressing the kinase-inactive PKCgammaK380R were indicated as controls. Demonstration of alpha and beta-casein phosphorylation by 124-v-Mos | In search of further substrates for the 124-v-Mos protein kinase we tested MBP; histone HI, H2AS, H3; protamine; protaminsulphate; purified PKC-alpha/-beta II/gamma and alpha- and beta-casein. With the exception of alpha- and beta-casein (fig. ) none of these substrates were phosphorylated by 124-v-Mos (data not shown). The possibility that factors other than 124-v-Mos in the immunoprecipitate might be responsible for the observed casein phosphorylation was eliminated by including a synthetic kinase-inactive construct of 124-v-Mos, 124-v-MosK121R, as a control in addition to the Mos-unreleated protein, PKC_K380R. A comparison of background phosphorylation on beta-casein in the immunoprecipitates of both controls and 124-v-Mos specific phosphorylation showed that 124-v-Mos phosphorylates beta-casein 7fold relative to background (fig. ). Critically, a tryptic digest of phosphorylated beta-casein revealed that 124-v-Mos phosphorylates a specific tryptic peptide in beta-casein which shows no background phosphorylation in either controls (fig. , arrowhead) strongly supporting that 124-v-Mos is able to phosphorylate beta-casein. Further, a two-dimensional phosphoamino acid analysis (fig. ) showed that 124-v-Mos phosphorylates alpha- and beta-casein on serine and threonine residues at a ratio of 1:1. Figure 3 | 124-v-Mos phosphorylates alpha- and beta-casein in vitro. 124-v-Mos phosphorylates alpha- and beta-casein in vitro. Mos kinase assays, in the presence of alpha- and beta-casein, were resolved using 10% SDS-PAGE; the Coomassie stained protein gel shown in 3A, right panel and the corresponding autoradiograph on the left panel. Arrowheads indicate the position of 124-v-Mos, alpha- and beta-casein and the antibody. Using two control immunoprecipitates of Sf9 cells expressing the synthetic kinase-inactive constructs, 124-v-MosK121R or PKCgammaK380R, Mos-specific beta-casein phosphorylation was demonstrated in 3B and 3C: Mos kinase assays were blotted on nylon-membrane, the phospho-beta-casein bands (B, arrowhead) excised and 32P-Cerenkov counts recorded (B). Alternatively, the excised phospho-beta-casein bands were digested with trypsin and electrophoresed using 16% SDS-PAGE (C). The arrowhead in 3C indicates the tryptic beta-casein peptide phosphorylated by wild-type 124-v-Mos only. Further, two-dimensional phosphoamino acid analyses of 124-v-Mos phosphorylated alpha-casein (D, left panel) and beta-casein (D, right panel) were completed, the arrowheads indicating the origins of sample application. The protein tyrosine phosphatase 1B is a novel in vitro substrate for 124-v-Mos | Protein tyrosine phosphatases constitute a diverse family of enzymes that can be divided into several subgroups, including receptor and non-receptor PTPs . The non-transmembrane protein tyrosine phosphatase PTP-1B, a major intracellular PTP is widely expressed. PTP-1B has been demonstrated to be phosphorylated on multiple sites in a cell cycle specific manner whereby mitotic hyper-phosphorylation occurs, reflected by a protein mobility shift in SDS-PAGE analyses . Using purified PTP-1B as a substrate, we show here that 124-v-Mos can phosphorylate PTP-1B in vitro (fig. ). We controlled this result by using immunoprecipitates from Sf9 cells expressing the synthetic kinase-inactive 124-v-Mos construct or purified PTP-1B alone in parallel kinase assays (fig. ). Other kinases such as PKC and CKII that phosphorylate PTP-1B in vitro are unable to induce a mobility shift of PTP-1B as observed in mitotic cells . Likewise, as shown in figure , a Mos-dependent phosphorylation did not result in a mobility shift of PTP-1B. Figure 4 | PTP-1B is a substrate for 124-v-Mos in vitro. PTP-1B is a substrate for 124-v-Mos in vitro. In vitro Mos kinase assays, using purified PTP-1B as a substrate, were resolved using 10% SDS-PAGE and the autoradiograph is shown in 4A. Immunoprecipitates of Sf9 cells expressing the kinase-inactive 124-v-MosK121R variant or PTP-1B alone were included as controls (A,B). A parallel kinase assay was blotted on nylon-membrane and PTP-1B was detected (B) using the PTP-1B-specific antiserum FG6 , arrowheads indicate the position of 124-v-Mos and PTP-1B. Discussion : In this study we have expressed constitutive active 124-v-Mos using the baculovirus expression system and identified novel in vitro substrates for Mos by immunocomplex kinase assays. It has been shown that 124-v-Mos from mos-transformed mouse fibroblasts phosphorylates vimentin in vitro and that v-Mos is physically associated with vimentin in transformed cells . We have used vimentin as a positive control for 124-v-Mos kinase assays in vitro to demonstrate protein kinase activity of baculovirus expressed 124-v-Mos (fig. ). It is known that the kinase activity of c-Mos is regulated by cellular factors and therefore we have chosen the oncogenic variant of c-Mos, 124-v-Mos, in our study since it is independent of activating mechanisms. Recently it has been shown that Hsp70 and Hsp90 physically interact with c-Mos in Xenopus oocytes and are required for c-Mos activation . Another factor controlling c-Mos kinase activity in Xenopus oocytes was identified by Chen and colleagues to be CKII, a tetrameric holoenzyme composed of two catalytic alpha-subunits and two regulatory beta-subunits . In Xenopus oocytes c-Mos kinase activity is inhibited by binding to the C-terminus of CKII beta-subunit and by over-expression of the alpha-subunit of CKII this effect can be neutralized suggesting a binding competition between c-Mos and the alpha-subunit of CKII . Another protein that interacts with c-Mos in Xenopus oocytes is tubulin. Tubulin not only co-precipitates with c-Mos but also serves as an in vivo and in vitro substrate . In contrast, tubulin was not a substrate for 124-v-Mos in our immunocomplex kinase studies (fig. ). Possibly, this indicates that a cellular factor present in Xenopus oocytes and co-precipitating with c-Mos might be necessary for tubulin phosphorylation by the Mos protein kinase. This factor might not interact with the v-Mos protein, be absent in Sf9 insect cells or unable to interact with v-Mos. Interestingly, we have not detected any co-precipitation of the _-subunit of CKII from Sf9 cells with 124-v-Mos in our immunoprecipitates (data not shown). However, as previously mentioned, Hsp70 is known to interact also with 124-v-Mos . Having established that our recombinant 124-v-Mos protein is active in vitro, we tested a variety of molecules in immunocomplex kinase assays and identified alpha- and beta-casein as very good substrates in vitro (fig. ). This phosphorylation was specific to active 124-v-Mos as the overall phosphorylation on casein was significantly reduced using the synthetic kinase-inactive construct 124-v-MosK121R and more importantly, a tryptic peptide of casein was identified to be phosphorylated by 124-v-Mos only and not by either of the controls used in this study. As expected, casein phosphorylation occured on serine and threonine residues. The Mos-specific consensus phosphorylation site has not as yet been identified and only the mos-phosphorylation sites on MAP kinase kinase have been mapped revealing them to be identical to raf-phosphorylation sites . Using the mos substrates identified in this study, it may be possible to determine the specific consensus phosphorylation site for the mos protein kinase as a basis for developing Mos-specific inhibitors. We have also identified protein tyrosine phosphatase 1B (PTP-1B) as a substrate for 124-v-mos in vitro (fig. ). PTP-1B is phosphorylated on multiple sites in vivo and during mitosis becomes hyper-phosphorylated resulting in a mobility shift in SDS-PAGE . Protein kinase C and CKII phosphorylate PTP-1B in vitro but neither is responsible for the observed mitotic hyper-phosphorylation in vivo . We show here that likewise PTP-1B phosphorylation by 124-v-mos is insufficient to effect a mobility shift (fig. ). PTP-1B phosphorylation occurs on serine 386, a phosphoacceptor site for Cdc2/cyclin B in vitro and serine 352, phosphorylated by an unknown kinase. The serine 352 phosphorylation site either might not be a target for Mos in vitro or PTP-1B may be sequentially phosphorylated by multiple kinases in vivo. Interestingly, it has been shown that PTP-1B hyper-phosphorylation does not occur uniquely in mitosis but also during osmotic shock and is induced by several other stress stimuli . Given that activation of c-Mos is dependent on its interaction with the heatshock proteins, Hsp70 and Hsp90, it is tempting to speculate that the Mos kinase may phosphorylate PTP-1B also in vivo. Conclusions : The crucial biological functions of c-mos during meiosis have been analysed by antisense experiments in Xenopus lavis and by generating mos-deficient mice establishing mos as the main player in metaphase II arrest. In contrast, not much is known about activating mechanisms of mos and biochemical properties such as the mos-specific consensus phosphorylation site. In this study we immunopurified an oncogenic and constitutive active variant of mos, 124-v-Mos, and identified novel phosphorylation substrates, PTP1B and alpha- and beta-casein. Our substrates represent a basis to determine the consensus mos-specific phosphorylation site and further, to analyze this phosphorylation ability functionally in vivo. Materials and Methods : Protein expression and in vitro immunocomplex protein kinase assays | The construction and isolation of recombinant baculoviruses expressing active 124-v-Mos and the synthetic kinase-inactive variant of 124-v-Mos, 124-v-MosK121R, is described in detail elsewhere . According to the standard procedure published by Summers & Smith , recombinant proteins were expressed at 27C in Sf9 cells for 48 hrs. and mos was immunopurified using the anti-Mos N13 antiserum as stated in . Mos kinase assays were carried out in 50 _l kinase reaction buffer (10 mM HEPES pH 7.3, 150 mM NaCl, 0.1% Triton X-100, 2 mM DTT, 15 mM MnCl2, 5 mM MgCl2, 2.5 mM beta-glycerophosphate, 2.5 mM NaF, 20 muM ATP/ 10 muCi [_gamma32P]ATP), incubated for 20 min. at 25C and stopped by the addition of Laemmli buffer. For in vitro substrate kinase assays, 2 mug of substrate was added to each kinase reaction. Phosphoproteins were resolved using 10% SDS-PAGE, Coomassie stained, dried and compared with the corresponding autoradiograph. Immunodetection of western blots were performed using the ECL system and protocol (Amersham). Substrates for in vitro immunocomplex kinase assays | alpha- and beta-casein (dephosphorylated, bovine origin) were purchased from Sigma and vimentin from Roche. Purified PTP-1B and the PTP-lB-specific antiserum FG6 were provided by N. Tonks, Cold Spring Harbor . Tubulin was purified from either mouse brain, testis or spleen by F. Propst, Vienna. Two-dimensional phosphoamino acid analyses | Two-dimensional phosphoamino acid analyses were completed according to Boyle and colleagues . Briefly, phosphoproteins were separated using SDS-PAGE, blotted on nylon-membrane and the desired protein bands were excised. The membrane strips were washed sequentially with 100% methanol and water and the phosphoproteins hydrolysed for 60 min. at 110C in 5.7 N HCl. The hydrolysed samples were lyophilised, resuspended in 2.5% formic acid, 7.8% acetic acid and mixed at 15:1 with a non-radioactive amino acid standard (1 mg/ml of each phospho-serine, -threonine, -tyrosine; Sigma). Finally, samples were spotted on thin-layer chromatography plates and separated in two dimensions using the HTLE-7000 apparatus and manufacture's procedure (Two-Dimensional Peptide Mapping And Phosphoamino Acid Analysis, Featuring The Hunter Thin Layer Plate Electrophoresis System. B. Boyle & T. Hunter, C.B.S. Scientific Company, Del Mar, USA). First dimension: 20 min. electrophoresis at 0.8 bar, 1 kV in 2.5% formic acid, 7.8% acidic acid. Second dimension: 16 min. at 0.8 bar, 1.3 kV in 5% acidic acid, 0.5 % pyridine. The phosphoamino acids were fixed for 10 min. at 65C and the standard non-radioactive amino acids visualised by spraying the chromatography plates with 0.25% ninhydrin followed by incubation for 15 min. at 65C. The phosphoamino acids were located by comparing the autoradiograph with the stained standard amino acids. Tryptic digests and one- or two-dimensional separation of tryptic phosphopeptides | According to Boyle and colleagues phosphorylated proteins were proteolytically digested with trypsin by incubating twice for 2 hrs. at 37C, on each occasion with 10 mug trypsin (Promega, modified trypsin, sequencing grade) in 200 mul 50 mM NH4HCO3 and a two-dimensional separation of tryptic phosphopeptides was completed using the HTLE-7000 apparatus and manufacture's protocol: electrophoretic separation was performed on thin layer chromatography plates for 25 min. at 0.8 bar and 1 kV, followed by conventional chromatography in 39.25% n-butanol, 30.25% pyridine, 6.1% acetic acid. One-dimensional separation of tryptic phosphopeptides was achieved using 16% SDS-PAGE according to Schagger and von Jagow . List of Abbreviations used : Sf9, Spodoptera frugiperda cell line; MAPK, mitogen-activated protein kinase; MEK, MAP and erk kinase; Hsp, heat-shock protein; PTP, protein tyrosine phosphatase; MBP, myelin basic protein; PKC, protein kinase C; CKII, casein kinase II. Backmatter: PMID- 12014993 TI - Mitochondria from cultured cells derived from normal and thiamine-responsive megaloblastic anemia individuals efficiently import thiamine diphosphate AB - Abstract | Background | Thiamine diphosphate (ThDP) is the active form of thiamine, and it serves as a cofactor for several enzymes, both cytosolic and mitochondrial. Isolated mitochondria have been shown to take up thiamine yet thiamine diphosphokinase is cytosolic and not present in mitochondria. Previous reports indicate that ThDP can also be taken up by rat mitochondria, but the kinetic constants associated with such uptake seemed not to be physiologically relevant. Results | Here we examine ThDP uptake by mitochondria from several human cell types, including cells from patients with thiamine-responsive megaloblastic anemia (TRMA) that lack a functional thiamine transporter of the plasma membrane. Although mitochondria from normal lymphoblasts took up thiamine in the low micromolar range, surprisingly mitochondria from TRMA lymphoblasts lacked this uptake component. ThDP was taken up efficiently by mitochondria isolated from either normal or TRMA lymphoblasts. Uptake was saturable and biphasic with a high affinity component characterized by a Km of 0.4 to 0.6 muM. Mitochondria from other cell types possessed a similar high affinity uptake component with variation seen in uptake capacity as revealed by differences in Vmax values. Conclusions | The results suggest a shared thiamine transporter for mitochondria and the plasma membrane. Additionally, a high affinity component of ThDP uptake by mitochondria was identified with the apparent affinity constant less than the estimates of the cytosolic concentration of free ThDP. This finding indicates that the high affinity uptake is physiologically significant and may represent the main mechanism for supplying phosphorylated thiamine for mitochondrial enzymes. Keywords: Background : Thiamine is a water-soluble, B-complex vitamin that cannot be synthesized by mammals, and thus thiamine can be obtained only from dietary intake. This can lead to severe consequences in humans when thiamine is limiting; thiamine deficiency may result in beriberi and the Wernike-Korsakoff syndrome . Being positively charged and present in relatively low plasma concentrations, thiamine movement across cellular membranes requires transporters. Upon being taken up by a cell, thiamine is rapidly diphosphorylated by thiamine diphosphokinase to give thiamine diphosphate (ThDP) . Thus, thiamine represents only a few percent of the total cellular thiamine/thiamine phosphate derivatives. ThDP serves as a cofactor for several enzymes that are found both in the cytosol (transketolase) and mitochondria (alpha-ketoglutarate dehydrogenase complex being the most studied example). The intracellular concentration of ThDP has been estimated at 30 muM, with only about 7 percent being free cytosolic and the remainder being enzyme-bound with much of this within mitochondria . Previous findings indicate a complex, cell-type dependent regulation of compartmentalization and intracellular pools of thiamine and its phosphorylated derivatives in response to fluctuating extracellular thiamine levels . Hence, thiamine transport, including that by mitochondria, is of interest. Thiamine entry into mammalian cells occurs by a saturable, high affinity transporter that is deficient in humans with thiamine-responsive megaloblastic anemia (TRMA) . Thiamine uptake by mitochondria has been demonstrated , yet thiamine diphosphokinase is cytosolic and mitochondria cannot convert thiamine to ThDP . Barile and coworkers demonstrated saturable uptake of ThDP by rat liver mitochondria characterized by a Km of around 20 muM. Although the estimated concentration, in mice and human cells, of intracellular ThDP is about 30 muM, much of this is found in a low turnover pool representing enzyme-bound ThDP . The estimated concentration of free cytosolic ThDP available for intracellular transport is about 10% of the total concentration and thus 2 to 3 muM . Hence the physiological significance of the mitochondrial ThDP uptake just decribed is uncertain. Within mitochondria, ThDP can be converted to thiamine monophosphate . Thiamine or ThDP entry into mitochondria from TRMA cells has not been studied. Interestingly, ThDP-utilizing enzymes in mitochondria are much less affected (as revealed by loss of activity) upon progressive depletion of thiamine available to TRMA cells than are ThDP-utilizing enzymes of the cytosol . For these reasons, we have examined the uptake of thiamine and especially ThDP by mitochondria from several human cell types, including cells from TRMA patients. Results : Uptake of thiamine by cells and mitochondria | Although our interests primarily were in mitochondrial uptake of thiamine and its derivatives, we first examined cellular uptake of thiamine by the lymphoblast cell lines and found thiamine uptake properties typical of other mammalian cells. Figure indicates thiamine uptake by normal lymphoblasts and lymphoblasts derived from a TRMA patient. The high affinity transport of thiamine by normal lymphoblasts is abolished in the presence of a 100 fold excess of unlabeled thiamine. Under such conditions, some uptake continues from a low affinity (Km in the mM range) transport mechanism and/or from diffusion that characterizes thiamine uptake in all mammalian cells examined to date. Using an expanded range of thiamine concentrations from that shown in fig. in multiple experiments resulted in a Km of 1.0 +- 0.9 muM for the high affinity transport by normal lymphoblasts. As expected, lymphoblasts derived from the TRMA patient showed no high affinity thiamine transport as revealed by thiamine uptake being the same in the absence and presence of excess unlabelled thiamine. Figure 1 | Uptake of radioactive thiamine by normal and TRMA lymphoblasts and mitochondria isolated from the lymphoblasts. Uptake of radioactive thiamine by normal and TRMA lymphoblasts and mitochondria isolated from the lymphoblasts. A. Late log phase lymphoblasts from normal (squares) or TRMA individuals (circles) were incubated for 30 minutes with various concentrations of radioactive thiamine. Incubations were carried out in the absence (unfilled symbols) or presence (filled symbols) of a 100 fold excess of non-radioactive thiamine (at each concentration). Cell-associated counts per minute were determined, and the velocity (V) (pmol thiamine per 2 x 106 cells per min.) is plotted versus the concentration (in micromolar) of radioactive thiamine.). Error bars represent SEM for two independent experiments. B. Mitochondria were isolated from lymphoblasts derived from normal (squares) or TRMA individuals (circles) were incubated for 15 minutes with various concentrations of radioactive thiamine. Incubations were carried out in the absence (unfilled symbols) or presence (filled symbols) of a 100 fold excess of non-radioactive thiamine (at each concentration). Mitochondrial-associated counts per minute were determined, and the velocity (V) (pmol thiamine per mg mitochondrial protein per min.) is plotted versus the concentration (in micromolar) of thiamine.). Error bars represent +- SEM for two independent experiments. C. Western anaylsis indicating the presence of the thiamine transporter in plasma membrane fractions and in mitochondrial fractions. Equivalent volumes of subcellular fractions were electrophoretically separated, blotted to a filter, and probed using antisera specific for the human thiamine transporter that is mutated in TRMA individuals. Lane 1, plasma membrane fraction; 2, initial mitochondrial fraction; 3 and 4, successive washes of the mitochondrial fraction; 5, final mitochondrial fraction. 75 micrograms of protein were loaded into each lane with the exception of the lanes containing the washes (3 and 4) which were not quantitated. A faint but reproducible (using different preparations) band was found in the final mitochondrial fraction. Mitochondria isolated from normal lymphoblasts also were found to take up thiamine (fig. ) in a manner similar to that of cellular uptake, with both a high and low affinity component. Using an expanded range of thiamine concentrations in multiple experiments resulted in a Km of 2.1 +- 0.4 muM for high affinity thiamine uptake by normal lymphoblast mitochondria. Interestingly, mitochondria from TRMA lymphoblasts did not possess a "high affinity" thiamine transport capacity as did mitochondria form normal lymphoblasts. No difference in uptake of thiamine by TRMA mitochondria was found in the presence and absence of excess unlabelled thiamine (fig. ). This finding suggests that cellular and mitochondrial uptake of thiamine may be mediated by the same transporter since TRMA is defined by mutation within the thiamine transporter located on the plasma membrane . Using antiserum specific for the human thiamine transporter that is mutated in TRMA individuals, western analysis consistently resulted in a faint but detectable band within the isolated mitochondrial suspension (fig. ), even after extensive and multiple washing. Uptake of ThDP by mitochondria | Although mitochondria from lymphoblasts (above) and other mammalian cells were found to take up thiamine, the physiological significance of the uptake is unknown given that thiamine diphosphokinase is cytosolic and mitochondria cannot convert thiamine to ThDP . We thus were interested in uptake of ThDP by mitochondria, a possibility demonstrated previously with rat liver . Mitochondria from normal human lymphoblasts were able to take up ThDP in a saturable, biphasic manner (fig. ) with a first saturation in the submicromolar range (described below) and a second at much higher concentrations of ThDP. Time course experiments indicated ThDP uptake was linear for at least 20 minutes (data not shown), and uptake was linear with the amount of mitochondrial protein added (inset of fig. ). Figure 2 | The rate of uptake of ThDP by mitochondria isolated from normal lymphoblasts. The rate of uptake of ThDP by mitochondria isolated from normal lymphoblasts. Mitochondria were isolated from normal lymphoblasts and were incubated for 15 minutes with various concentrations of radioactive ThDP. Mitochondrial-associated counts were determined, and the velocity (V) (pmol ThDP per mg mitochondrial protein per min.) is plotted versus the concentration in micromolar of ThDP ([S]). Error bars represent SEM for four independent experiments. The inset shows uptake (V, pmol ThDP per mg mitochondrial protein per min.) versus varying amounts of resuspended mitochondria (mug of protein) in the presence of 2 M radioactive ThDP. Although the biphasic nature of the uptake is readily seen in various plots of the data, the existence of the high affinity component perhaps is best illustrated in fig. in which the uptake at submicromolar concentrations of ThDP is illustrated (open squares). Uptake of ThDP was repeated in the presence of 30 muM non-radioactive ThDP, a concentration that is 100 to about 40 fold excess over the concentration of radioactive ThDP that was used. Given the Km values for the high and low affinity components (see below), this excess should abolish most of the high affinity uptake but have little to no effect on the low affinity uptake. The uptake due solely to the low affinity component was calculated using the kinetic parameters determined for this component and was plotted as open triangles. As seen in fig. , uptake in the presence of 30 muM non-radioactive ThDP (open circles) was essentially identical to that calculated for the low affinity component and abolition of the high affinity uptake indeed was observed. Figure 3 | The rate of uptake of ThDP at submicromolar concentrations by mitochondria from normal lymphoblasts. The rate of uptake of ThDP at submicromolar concentrations by mitochondria from normal lymphoblasts. Mitochondria were isolated from normal lymphoblasts and were incubated for 15 minutes with various concentrations of radioactive ThDP in the absence (open squares) or presence (open circles) of 30 muM nonradioactive ThDP. Mitochondrial-associated counts were determined, and the velocity (V) (pmol ThDP per mg mitochondrial protein 15 min.) is plotted versus the concentration in micromolar of radioactive ThDP ([S]). The calculated V versus [S] for the low affinity component only, using the kinetic parameters for that component, also is plotted (open triangles). Error bars represent +- SEM for four independent experiments in the absence and three experiments in the presence of non-radioactive ThDP. Using the data from 4 independent experiments resulted in the determination of a Km of 0.38 muM for the high affinity (table ) and 115 muM for the low affinity uptake components. The high affinity Km value compares favorably with the estimated 2 to 3 muM intracellular concentration of free ThDP. Table 1 | Kinetic constants for the high affinity component of ThDP uptake by mitochondria isolated from various cell types. Mitochondria isolated from TRMA lymphoblasts took up ThDP in an essentially identical saturable, biphasic fashion as uptake by normal mitochondria (fig. ). The inset compares the Lineweaver-Burk plot of the high affinity uptake component for mitochondria of both cell types. A high affinity Km of 0.60 (table ) was calculated for mitochondrial uptake of ThDP for TRMA lymphoblasts, a value that is essentially the same as that for mitochondria isolated from normal lymphoblasts. The results indicate that although mitochondria from TRMA lymphoblasts cannot take up thiamine with high affinity, they can efficiently import ThDP, the active form of thiamine. Figure 4 | The rate of uptake of ThDP by mitochondria isolated from normal and TRMA lymphoblasts. The rate of uptake of ThDP by mitochondria isolated from normal and TRMA lymphoblasts. Mitochondria were isolated from normal (open squares) or TRMA (open circles) lymphoblasts and were incubated for 15 minutes with various concentrations of radioactive ThDP. Mitochondrial-associated counts were determined, and the velocity (V) (pmol ThDP per mg mitochondrial protein per min.) is plotted versus the concentration in micromolar of ThDP ([S]). The inset shows the Lineweaver-Burk plot (1/V vs. 1/S) of the high affinity component of ThDP uptake for normal (open squares) and TRMA (open circles) derived mitochondria. Previous work has indicated that different cell types may differentially regulate intracellular pools of thiamine and/or its phosphorylated derivatives . Thus, we examined ThDP uptake by several other cell types. As shown in table , high affinity uptake of ThDP by mitochondria from fibroblasts and neuroblastoma cells was essentially the same as that for normal and TRMA lymphoblasts as revealed by the similar Km values. The apparent affinity for ThDP characteristic of the high affinity uptake component was essentially identical for all cell types examined, however variation was seen in transport capacity, as revealed by substantially different values for Vmax (table ). Mitochondria from all of the cell types examined also possessed the low affinity uptake characterized by Km's similar to that of normal lymphoblasts but with a greater range of values being found (20 to 115 muM). The final entry in table is for ThDP uptake by mitochondria isolated from glyB cells. GlyB cells are a Chinese hamster ovary cell line that is deficient in the transport of folate into mitochondria. For reasons discussed below, ThDP uptake was examined in these cells. As seen in table , high affinity uptake was found with kinetic constants similar to those of the human cell types. The low affinity uptake component was also similar to that by human mitochondria (data not shown). Discussion + Conclusion : As has been reported for mitochondria of rat liver , mitochondria from human lymphoblasts were found herein to take up thiamine in a saturable manner characterized by a Km of 2.1 muM. Upon entry into a cell, thiamine is rapidly diphosphorylated to ThDP, resulting in a low intracellular thiamine concentration . The Km determined here is about an order of magnitude greater than the estimated intracellular thiamine concentration , raising questions about the efficiency of such uptake. Surprisingly, mitochondria derived from TRMA lymphoblasts lacked the high affinity uptake of thiamine. TRMA is caused by mutations which destroy the high affinity thiamine transporter of the plasma membrane . The similar Km values found for cellular and mitochondrial uptake of thiamine for normal lymphoblasts and the lack of such uptake by TRMA mitochondria and TRMA cells suggests that high affinity thiamine import into mitochondria may be carried out by the same transporter or a variant form, perhaps generated by differential splicing, of that serving on the plasma membrane. Although western analysis using anti-human transporter (that is mutated in TRMA individuals) antiserum supports this interpretation, further experiments need to be carried out to substantiate the suggestion of a shared thiamine transporter between these two membrane systems. Even if true, the physiological significance of thiamine uptake by mitochondria is unknown since mitochondria cannot form ThDP from thiamine . We find that mitochondria from a variety of human cell types efficiently take up ThDP. Uptake is biphasic with a high and a low affinity component. The Km values characteristics of the high affinity uptake component (all around 0.4 muM) are comparable to the estimated intracellular concentration of free (non-enzyme bound) cytosolic ThDP of around 3 muM . This suggests that the high affinity uptake system is the physiologically relevant mechanism responsible for ThDP entry into mitochondria. Earlier work with rat liver mitochondria identified a ThDP uptake system with an estimated Km of around 20 muM . This is of the same order of magnitude that we find for the low affinity component in the human cells examined herein. The previous work used a less sensitive procedure of examining ThDP uptake and did not examine uptake below 10 muM. This would explain the lack of identification in the previous work of the high affinity uptake component. There is a high degree of amino acid similarity among folate transporters and the thiamine transporter of the plasma membrane . Recently, it was found that in murine cells there can be a substantial efflux of ThDP mediated by the reduced folate carrier protein . GlyB cells are a Chinese hamster ovary cell line derivative that are deficient in the transport of folates into mitochondria, and the responsible mitochondrial transporter has recently been identified and its gene cloned . We wondered if the mitochondrial folate transporter was responsible for uptake of ThDP into mitochondria, making analogies to the ability of the plasma membrane folate transporter being able to transport ThDP. However, this is not the case as glyB cells that lack the mitochondrial folate transporter were found to take up ThDP with high affinity kinetics similar to that of mitochondria of human cells. Mitochondria from three human cell types -- lymphoblasts, fibroblasts, and neruoblastoma cells -- all possessed a high affinity ThDP uptake component characterized by equivalent apparent affinity for ThDP as revealed by essentially identical Km values. Previous studies indicate the existence of a complex, cell-type dependent regulation of compartmentalization and intracellular pools of thiamine and/or its phosphorylated derivatives in response to fluctuating extracellular thiamine levels . The cell lines used here were also used in the studies leading to this conclusion. Clearly, differences in mitochondrial transporter affinities do not contribute to the cell-type dependent regulation of ThDP compartmentalization. However, we did find significant differences in ThDP uptake capacity with respect to cell type as revealed by variation in the Vmax values. Neuroblastoma mitochondria possessed the largest uptake capacity, having a Vmax 4 to 30 fold higher than that of the other cell types examined. Interestingly, of the three cell types neuroblastoma cells also are the most resistant to changes in mitochondrial ThDP-utilizing enzyme activity upon progressive depletion of the thiamine made available to the cells . This suggests that cell-dependent variation in ThDP uptake capacity by mitochondria may contribute to the cell-dependent regulation of ThDP compartmentalization. As such regulation was most clearly revealed upon progressively depleting thiamine from cells , it will be of interest to examine possible changes in mitochondrial transport capacity in response to thiamine depletion. Studies on the sensitivity of ThDP-utilizing enzymes to progressive depletion of thiamine that is available to the cell indicate that such enzymes in mitochondria are significantly less sensitive than cytosolic enzymes in TRMA cells . This could be interpreted as efficient import of thiamine/ThDP into mitochondria in TRMA cells even though thiamine inefficiently enters these cells due to the lack of the high affinity thiamine transporter. Although we found a lack of mitochondrial uptake of thiamine in TRMA cells, our finding of an intact, high affinity ThDP transport mechanism for TRMA mitochondria is consistent with and offers an explanation for such an interpretation. Materials and Methods : Radiochemicals | [3H]thiamine (1 Ci/mmol, radiochemical purity greater than 97%) and [3H]thiamine diphosphate (1.4 Ci/mmol, radiochemical purity greater than 98 %) were purchased from Moravek Biochemical Inc (Brea, CA). Cell culture | Normal lymphoblasts, TRMA lymphoblasts and fibroblasts cell lines were obtained and have been characterized as described . The human neuroblastoma cells were an SY-SY5Y cell line, a thrice-cloned subline of SK-N-SH . GlyB cells, a Chinese hamster ovary K1 subline, are deficient in the transport of folate into mitochondria and were a kind gift from L. Chasin (Columbia University). All cell types were growth at 37C in the presence of 10 muM thiamine in RPMI 1640 medium supplemented with 10% heat-inactive fetal calf serum, 2 mM L-glutamine and 1 g/L penicillin/streptomycin, except glyB cells which were grown in MEM medium. Cells were grown and used at late log phase or at 80 --90% confluency. Cellular thiamine transport | Cells were harvested, washed four times with 40 ml of ice-cold transport buffer (145 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 10 mM glucose, 10 mM HEPES, pH 7.4), titered, and preincubated for 30 min. at 37C after resuspending 3 x 107 cells in 1 ml of transport buffer. Various amounts of [3H]thiamine (to give submicromolar and micromolar final concentrations) were added and the reactions were incubated for 30 min. The specific activity of the radioactive thiamine was the same for each concentration used. The cells were collected by rapid filtration onto glass fiber filters (type A/E, Gelman Sciences, Ann Arbor, MI) and washed via filtration with 10 ml of cold transport buffer. After thorough drying (overnight at 60C), the amount of labeled thiamine taken up by the cells was determined by scintillation counting . For each concentration, the uptake in the presence of a 100-fold excess of unlabelled thiamine was performed to assess the contribution to uptake from a low affinity (Km in the mM range) component and/or from diffusion . Isolation of mitochondria | Mitochondria were isolated from about 3 x 108 cells according to published procedures . The final mitochondrial pellet was suspended in suspension buffer (140 mM KCl, 0.3 mM EDTA, 5 mM MgCl2, 10 mM HEPES, pH 7.4) to give a protein concentration of 3 --4 mg/ml. Protein concentration was determined using the Bio-Rad DC Protein Assay Kit (Bio-Rad Laboratories, Hercules, CA). The isolation and purity of the mitochondrial preparations were monitored by western analysis using anti-cytochrome C antiserum and by microscopy. Western analysis also was performed on the subcellular fractions using antiserum raised against a human thiamine transporter-specific peptide. The antiserum detects a protein of 55 KD (predicted size of the plasma membrane thiamine transporter) that is not detected in cells from TRMA individuals that possess a premature stop codon within the transporter gene (unpublished results). Uptake of thiamine and ThDP by mitochondria | Uptake of thiamine and ThDP by mitochondria was determined by a rapid filtration procedure . Incubations were performed at 37C by rapidly mixing 30 mul of mitochondrial suspension (ca. 100 micrograms of protein) with 220 mul of incubation buffer (140 mM KCl, 0.3 mM EDTA, 5 mM MgCl2, 10 mM Mes, pH 6.5) containing labeled thiamine or ThDP at various concentrations. The uptake was stopped at 15 min. by the addition of 2 ml of ice-cold stop buffer (100 mM KCl, 100 mM mannitol, 10 mM potassium phosphate, pH 7.4) and the mitochondria were collected by rapid filtration on 0.45 muM Millipore membrane filters. The filters were immediately washed with 5 ml of stop buffer via filtration, and they were subsequently dried at 60C overnight. The amount of labeled thiamine or ThDP taken up by the mitochondria was determined by scintillation counting. Background binding was determined by using a 100 fold excess of unlabelled thiamine or ThDP in parallel reactions. Authors' Contributions : QS carried out most of the experiments and participated in writing the manuscript. CKS conceived of the study, participated in its design and coordination, performed a few of the thiamine uptake by cells experiments, and participated in writing the manuscript. Abbreviations : thiamine diphosphate (ThDP); thiamine-responsive megaloblastic anemia (TRMA) Backmatter: PMID- 11972899 TI - Interconversion of Anthozoa GFP-like fluorescent and non-fluorescent proteins by mutagenesis AB - Abstract | Background | Within the family of green fluorescent protein (GFP) homologs, one can mark two main groups, specifically, fluorescent proteins (FPs) and non-fluorescent or chromoproteins (CPs). Structural background of differences between FPs and CPs are poorly understood to date. Results | Here, we applied site-directed and random mutagenesis in order to to transform CP into FP and vice versa. A purple chromoprotein asCP (asFP595) from Anemonia sulcata and a red fluorescent protein DsRed from Discosoma sp. were selected as representatives of CPs and FPs, respectively. For asCP, some substitutions at positions 148 and 165 (numbering in accordance to GFP) were found to dramatically increase quantum yield of red fluorescence. For DsRed, substitutions at positions 148, 165, 167, and 203 significantly decreased fluorescence intensity, so that the spectral characteristics of these mutants became more close to those of CPs. Finally, a practically non-fluorescent mutant DsRed-NF was generated. This mutant carried four amino acid substitutions, specifically, S148C, I165N, K167M, and S203A. DsRed-NF possessed a high extinction coefficient and an extremely low quantum yield (< 0.001). These spectral characteristics allow one to regard DsRed-NF as a true chromoprotein. Conclusions | We located a novel point in asCP sequence (position 165) mutations at which can result in red fluorescence appearance. Probably, this finding could be applied onto other CPs to generate red and far-red fluorescent mutants. A possibility to transform an FP into CP was demonstrated. Key role of residues adjacent to chromophore's phenolic ring in fluorescent/non-fluorescent states determination was revealed. Keywords: Background : Recently, homologs of the well-known green fluorescent protein (GFP) from jellyfish Aequorea victoria were discovered in Anthozoa species . These proteins can be subdivided into two main types. First type, fluorescent proteins (FPs), emit a significant portion (25 --80%) of the absorbed photons. Second type, chromoproteins (CPs), effectively absorb but practically do not emit light. Peculiarities of structure that make each GFP-like protein fluorescent or non-fluorescent are poorly understood to date. Only the importance of position 148 (we will use numbering in accordance to GFP, see Fig. ) was demonstrated in experiments on appearance of fluorescence in CPs . Introduction of Ser148 into several CPs made them clearly fluorescent, although the emission brightness of these mutants was significantly lower in comparison with wild type FPs. Figure 1 | Sequence alignment of asCP, GFP, and DsRed proteins. Sequence alignment of asCP, GFP, and DsRed proteins. The numbering is based on GFP. Introduced gaps are represented by dashes. The residues whose side chains form the interior of the beta-can are shaded. Mutations introduced in asCP and DsRed are designated under and below their sequences, respectively. Due to a great and still growing popularity of GFP and novel FPs in biotechnology, a comprehension of structure-function correlations in GFP-like proteins has both a scientific and a practical significance, showing novel possibilities to achieve desirable protein properties artificially. Here, we applied mutagenesis to a chromoprotein asFP595 (asCP) and a red fluorescent protein drFP583 (DsRed) to study transformation of a chromoprotein into a fluorescent protein and vise verse. Results : Although sequence comparison of known GFP-like proteins does not reveal absolutely invariable differences between FPs and CPs, one can draw attention to three positions, specifically, 148, 165, and 203, which are occupied by noticeably different residues in the two types of proteins (Fig. , Table ). Since residues at these positions are in a close proximity to chromophore , it is reasonable to presume that they can participate in the determination of the state (fluorescent or non-fluorescent) of a particular protein. Figure 2 | Schematic outline of the chromophores and selected neighboring residues in GFP (A), DsRed (B, D), and DsRed-NF (C, E, F) in "sticks" and "spacefill" representation. Schematic outline of the chromophores and selected neighboring residues in GFP (A), DsRed (B, D), and DsRed-NF (C, E, F) in "sticks" and "spacefill" representation. Carbon atoms are gray, nitrogen atoms are blue, and oxygen atoms are red. Images were generated by RasMol 2.6 software. Computer modeling for DsRed-NF was performed using Swiss-PdbViewer and HyperChem 5.01 software. Table 1 | Amino acids occupying positions 148, 165, and 203 (GFP numbering) in known GFP-like proteins. Random mutagenesis of asCP at position 148 | Earlier, we demonstrated for several CPs that Ser-148 containing mutants possess red fluorescence . To check other residue we fulfilled mutagenesis using degenerated primers encoding any amino acid at position 148. Visual inspection of about 50 recombinant clones and sequence analysis of the selected clones showed the following. Only Ser148 ensured clear fluorescence. Several intensively colored non-fluorescent clones contained Ala, Cys, Asn, or Gly at position 148 (remarkably, known wild type CPs carry the very Ala, Cys, or Asn at this position). All other substitutions of Ala148 appeared to be intolerable for proper protein folding and chromophore maturation. Mutagenesis of asCP at position 165 | First of all, we tested a substitution S165V because several FPs carry Val at this position. This mutation resulted in the appearance of a clearly visible red fluorescence with a maximum at 620 nm (Fig. , Table ). Interestingly, in comparison with the wild type asCP, the mutant asCP-S165V showed a strongly modified absorption spectrum which included an additional peak at 390 nm. Absorption at this wavelength produced a very weak (about 10-fold less than the red fluorescence) blue fluorescence at 465 nm. Figure 3 | Normalized spectra for selected mutants of asCP and DsRed. Normalized spectra for selected mutants of asCP and DsRed. Absorption (black solid lines), excitation (colored dashed lines), and emission (colored solid lines) spectra are shown for each mutant. Blue, green, or red excitation-emission lines correspond to color of fluorescence. (A) asCP-S165V. Blue fluorescence is about tenfold weaker than red. (B) asCP-S165A. (C) asCP-S165C. (D) asCP-S165T. Green emision is about twofold stronger than red. (E) DsRed-NF. Green emission peak is about threefold lower than red one. Table 2 | Spectral characteristics for some mutants of asCP and DsRed. To reveal other substitutions at position 165 that could lead to fluorescence appearance we exploited randomization at this position. As a result, several red fluorescent clones of different brightness were selected. The most bright clones carried the already known substitution S165V. All other fluorescent mutants were considerably (5 --10 fold) dimmer and contained Ala, Cys, or Thr165 (in decreasing brightness order). Absorption spectra for these mutants have a characteristic peak at about 390 nm, but it produces no detectable blue fluorescence . An interesting feature of these low fluorescent mutants is that their excitation spectra for red emission do not coincide with the absorption spectra. This phenomenon implies the existence of different spectral forms within a spectrally heterogeneous population of the mutant protein molecules. Red emitting spectral forms are underrepresented or they possess a very low extinction coefficient. At the same time, the major red light-absorbing spectral forms are non-fluorescent. Random mutagenesis of asCP | To extend the search of amino acid substitutions that are able to convert asCP into a fluorescent protein, we used random mutagenesis of the whole asCP gene. Visual screening of about 5000 recombinant clones revealed only one brightly fluorescent colony. Sequence analysis showed that this fluorescent mutant contained the already known substitution A148S. After a more thorough visual inspection we found several very weakly fluorescent clones containing the following substitutions: S68G; I72N; H176R/K219I; H203R; H203Q; Q220L . Importantly, two independent clones carrying different substitutions at position 203 were collected. Summing up, this experiment has not highlighted novel important sites, because all random mutants were considerably (3 --5 fold) dimmer than the mutants at positions 148 and 165 mentioned above. One can conclude that positions 148, 165 are probably the most important sites that influence the state of asCP. Mutagenesis of DsRed | Finally, we attempted to transform the fluorescent DsRed into a chromoprotein. First of all, mutation S148A was tested. Unexpectedly, this substitution did not exert a strong influence on the fluorescence -- quantum yield for DsRed-S148A mutant decreased by a factor of 1.5 only in comparison to the wild type protein . Then, on the base of this mutant, a series of mutants carrying substitutions I165S, K167M, and S203A,L in different combinations was generated. Position 167 was added to mutagenesis considering the crystallographic studies that revealed a direct interaction between Lys167 and chromophore's Tyr66 . This bond appeared to stabilize the ionized form of the DsRed fluorophore. Mutant proteins containing Leu203 were colorless because of unsatisfactory protein folding in E. coli. Following the spectral properties of other mutants, one can notice a gradient of emission intensity and conclude that all positions mentioned above are important for DsRed fluorescence . However, even a quadruple mutant S148A/I165S/K167M/S203A displayed a clearly visible fluorescence comparable to that of some asCP fluorescent mutants (e.g., asCP-S165V). Thus, this DsRed mutant can not be regarded as a true chromoprotein, although it is very close to the CP state because it possesses hundredfold decreased fluorescence in comparison to DsRed. Then, we tested Cys and Asn that are characteristic for some other known CPs at positions 148 and 165, respectively. Triple mutant DsRed-S148C/I165N/S203A possessed a low quantum yield similarly to the mutant S148A/I165S/K167M/S203A mentioned above. When a substitution K167M was added, the final quadruple mutant S148C/I165N/K167M/S203A became practically non-fluorescent . At the same time, this mutant named DsRed-NF intensively absorbed light. Altogether, these properties make DsRed-NF practically indistinguishable from wild type CPs. Spectra for DsRed-NF are shown in Fig. . An extremely weak dual-color fluorescence can be detected at high protein concentration only. Similarly to the low fluorescent mutants of asCP mentioned (see Fig. ), absorption and excitation spectra for DsRed-NF strongly differ from each other. Interestingly, excitation spectrum for green emission displays 2 peaks: a major peak at 410 nm and a minor peak at 490 nm. Such a shape of the excitation curve is similar to that of wild type GFP and has never been detected for DsRed mutants (to date, only EGFP-like single-peak excitation spectra were described for green-emitting mutants of DsRed ). Probably, the short-wave excitation peak corresponds to a neutral (protonated) form of GFP-like chromophore within DsRed-NF. Discussion : Great diversity of fluorescent and non-fluorescent colors in the family of GFP-like proteins poses an challenging problem of understanding its structural background. Mutagenetic studies lately demonstrated various transitions of fluorescence color in Anthozoa proteins: from red to green , from yellow to green, from green to yellow, and from green to red . Also, red and far-red fluorescent mutants of non-fluorescent CPs were generated . Basic investigation of relationship between fluorescent and non-fluorescent GFP-like proteins was the main goal of the present work. However, some practical applications of the results obtained can be considered. The first part of our work, attempts to convert asCP into FP, revealed importance of position 165 for fluorescence appearance. This finding can be applied on other CPs. To date, mutagenesis of natural CPs is the only way to generate a far-red FPs that are in high demand for various applications. Additional far-red fluorescence color broadens abilities of multicolor labeling and assays based on fluorescence resonance energy transfer (FRET). Knowledge about the ways of transforming CPs into FPs could help to generate novel far-red FPs when novel CPs with red-shifted absorption spectra are found. The second part of our work was to transform DsRed into CP. At first glance, such fluorescence quenching can not be used in practice. However, we found that DsRed-NF mutant can be used to resolve a problem of DsRed tetramerization that is the main disadvantage of this tag . When DsRed is fused with a target protein, especially with oligomeric protein, it often results in improper folding and functioning of the tagged partners as well as intensive aggregation of the fusion protein. To neutralize injurious consequences of DsRed tetramerization we suggest to use a simultaneous co-expression of DsRed-tagged proteins with excess free DsRed-NF. In this case mixed heterotetramers are formed so that DsRed becomes a "monomeric" tag (this approach will be published elsewhere). It was recently demonstrated that DsRed and asCP carry chemically distinct chromophores . Theoretically, spectral differences between DsRed and asCP and generally between FPs and CPs may be explained by the diversity of their chromophores. If so, the appearance of fluorescence in asCP mutants and the disappearance of fluorescence in DsRed mutants should resulted from formation of altered chromophores within these mutants. Alternatively, one may suggest that each chromophore type in GFP-like proteins can be fluorescent or non-fluorescent depending on the protein environment. Some observations speak in favor of this hypothesis. First, all key residues mentioned above (positions 148, 165, 167, and 203) are grouped in a close proximity to the phenolic ring of Tyr66 . Thus, they can more likely participate in stabilization and positioning of the chromophore but not in chromophore cyclization events that result in the diversity of chromophores. Second, asCP demonstrates a striking phenomenon of light-induced reversible increasing of fluorescence . This photoconversion clearly shows that an initially non-fluorescent protein molecule can be switched into a fluorescent state due to some conformation changes. It is well-known that GFP-like chromophores and other chromophores that are capable of cis-trans isomerization are practically non-fluorescent in solution because of fast relaxation of the excited state through chromophore isomerization . Probably, chromophore in FPs must be strongly stabilized by the amino acid environment to ensure high quantum yield, while chromophore surrounding within CPs should be more relaxed to allow energy of absorbed light to dissipate into heat. From this point of view, we can draw the following scheme of DsRed chromophore stabilization. According to the crystal structure of DsRed Ser148 and Lys167 hold the chromophore by a direct interaction with phenolate oxygen . Bulky Ile165 supports the ring of Tyr66 and prevents its movement required for the chromophore isomerization . Although Ser203 has no direct H-bonds with the chromophore in the wild type DsRed, such bonds could be formed in mutants with altered 148, 165 and 167 positions. Possibly, Ser203 in DsRed mutants can turn similarly to GFP Thr203 that forms an H-bond with chromophore's phenolate oxygen . Quantitative data on the influence of each substitution on fluorescence intensity speak in favor of this scheme. Comparing in pairs quantum yields for the available DsRed mutants that differ from each other by one substitution (see Table ), one can note the following. The contribution of each substitution strongly depends on mutation order: the later the substitution is introduced the stronger the impact is. For instance, the mutant S203A demonstrates the same quantum yield as the wild type protein. At the same time, an addition of S203A to the mutant S148A leads to a 1.5-fold decrease in quantum yield. Then, introducing Ala-203 into a double mutant S148A/K167M results in a 2.4-fold decreased fluorescence. Analogously, mutation K167M leads to 2-, 3.2-, or 8.6-fold decrease of quantum yield when Met167 is introduced as second, third or fourth substitution, respectively. Also, 4.8- or 12.9-fold decrease of fluorescence intensity is associated with substitution I165S added to S148A/S203A or S148A/K167M/S203A mutants, respectively. The model of several chromophore-stabilizing interactions mentioned above implies such tendency because the importance of each interaction must progressively increase in absence of one, two or more other bonds. Computer modeling of the chromophore environment within DsRed-NF showed the following . In contrast to Ser148 and Lys167 in DsRed, Cys148 and Met167 in DsRed-NF are incapable of stabilizing the chromophore by H-bonds with phenolate oxygen. Moreover, substitution I165N generates a vacant space near the chromophore (compare Fig. and ). We believe that this space is sufficient to ensure the chromophore cis-trans isomerization after light absorption . Thus, absence of phenolate-stabilizing interactions together with free space around the chromophore can explain an extremely low fluorescence quantum yield of DsRed-NF. Unfortunately, no protein structures for CPs were published to date. Obviously, further crystallographic studies of FPs, CPs, and their mutants are required to make valid conclusions about the structural background of differences between FPs and CPs. Conclusions : The ability for fluorescence of GFP-like proteins depends to a great extent on the surrounding of the phenolic ring of the chromophore. For asCP chromoprotein, mutations at positions 148 and 165 can lead to red fluorescence appearance. For DsRed red fluorescent protein, fluorescence can be quenched by mutagenesis at positions 148, 165, 167, and 203. This knowledge can be applied to other GFP-like proteins in effort of customizing spectral characteristics of FPs and CPs. Materials and Methods : Mutagenesis and protein expression | Site-directed mutagenesis was performed by PCR with primers containing target substitution using the overlap extension method . The Diversity PCR Random Mutagenesis kit (Clontech) was used for random mutagenesis of asCP, in conditions optimal for 4 --5 mutations per 1000 bp. All mutants were cloned into pQE30 vector (Qiagen), so that recombinant proteins contained 6-histidine tag at their N-termini. To express mutant proteins E. coli XL1 Blue cells were transformed with the plasmids according to standard protocols and spread onto 3 --4 Petri dishes with LB agar media supplemented with ampicillin for selection. After overnight growth at 37C the plates were stored for 2 --5 days at room temperature or 4C to allow proteins to mature completely. Then, the plates were washed with PBS. Cells were disrupted by sonication, and soluble recombinant proteins were purified on the TALON metal-affinity resin (Clontech). Spectroscopy | Absorption spectra were recorded on a Beckman DU520 UV/VIS Spectrophotometer. A Cary Eclipse Fluorescence Spectrophotometer (Varian) was used for measuring excitation-emission spectra. For molar extinction coefficient determination, we relied on measuring mature chromophore concentration rather than total protein concentration. DsRed and its mutants were alkali-denatured with equal volume of 2 M NaOH. asCP and its mutants were acid-denatured with equal volume of 2 M HCl. Under these conditions, DsRed and asCP chromophores absorb at 452 and 430 nm, respectively . The amounts of chromophore (that correspond to amounts of matured protein) were equalized among samples, absorption spectra for the native proteins were collected. Absorbance intensities were compared to that of DsRed (extinction coefficient is 75,000 M-1cm-1) or asCP (extinction coefficient is 56,000 M-1cm-1), and molar extinction coefficient for each mutant was estimated. For quantum yield determination, the fluorescence of the mutants was compared to equally absorbing DsRed (quantum yield for DsRed was measured to be 0.70 ). Backmatter: PMID- 12019031 TI - Expression of monolysocardiolipin acyltransferase activity is regulated in concert with the level of cardiolipin and cardiolipin biosynthesis in the mammalian heart AB - Abstract | Background | Monolysocardiolipin acyltransferase (MLCL AT) catalyzes the acylation of monolysocardiolipin to cardiolipin in mammalian tissues. We previously reported that cardiac cardiolipin levels, MLCL AT and cardiolipin synthase activities were all elevated in rats made hyperthyroid by thyroxine treatment. In this study, we examined if cardiac mitochondrial MLCL AT activity was dependent upon the biosynthesis and level of cardiolipin in the heart. Rat heart mitochondrial MLCL AT activity was determined under conditions in which the levels of cardiac cardiolipin and cardiolipin synthase activity were either reduced or unaltered using four different disease models in the rat. In addition, these parameters were examined in a murine model of cardiac cell differentiation. Results | In rats made hypothyroid by treatment with 6-n-propyl-2-thiouracil in the drinking water for 34 days, cardiac cardiolipin content was decreased 29% (p < 0.025) and this was associated with a 32% decrease (p < 0.025) in cardiolipin synthase and a 35% reduction (p < 0.025) in MLCL AT activities. Streptozotocin-induced diabetes or hyperinsulinemia in rats did not affect cardiac cardiolipin content nor MLCL AT and cardiolipin synthase activities. Finally, cardiolipin content, MLCL AT and cardiolipin synthase activities were unaltered during murine P19 teratocarcinoma cell differentiation into cardiac myocytes. In all models, phospholipase A2 activities were unaltered compared with controls. Conclusion | We propose a general model in which the expression of MLCL AT activity is regulated in concert with the biosynthesis and level of cardiolipin in the heart. Keywords: Background : Phospholipids are important structural and functional components of the biological membrane . Structurally, as major components of the biological membrane, they define compartmentalization of organelles and the protective barrier, the cell membrane, which surrounds cells. An important class of phospholipids are the polyglycerophospholipids. Cardiolipin (CL), the first polyglycerophospholipid discovered, was isolated from beef heart by Pangborn in 1942 . In the heart, CL represents approximately 12 --16% of the entire cardiac phospholipid mass and is found exclusively in mitochondria . In mammalian tissues CL is required for the reconstituted activity of a number of key mitochondrial enzymes involved in cellular energy metabolism including for example cytochrome c oxidase, carnitine palmitoyltransferase, creatine phosphokinase, pyruvate translocator, mono-, di- and tricarboxylate carriers, glycerol-3-phosphate dehydrogenase, phosphate transporter, ATP/ADP translocase and ATP synthase . Under experimental conditions in which CL was removed or digested away from these proteins with phospholipases, denaturation and complete loss in activity of many of these proteins was observed. CL interaction with these proteins was specific since substitution with other phospholipids did not fully reconstitute activity. The fatty acyl composition of CL also appeared to be important for this functional reconstitution. For example, the activity of delipidated rat liver cytochrome c oxidase was reconstituted by the addition of CL . The specific activity of reconstituted cytochrome c oxidase varied significantly with different fatty acyl compositions of CL. A strong positive correlation has been established between fatty acid unsaturation of CL and antioxidant production in cells . In staurosporine-treated granulosa cells undergoing apoptosis CL levels were reduced . Peroxidation of CL induced release of cytochrome c from mitochondria into the cytosol and this was associated with the induction of apoptosis . Suppression of CL peroxidation inhibited release of cytochrome c from mitochondria . Thus, the activities of the enzymes that synthesize and remodel CL play a pivotal role in maintaining the content and molecular composition of CL and hence may regulate a plethora of cellular processes from energy metabolism to apoptosis. In mammalian tissues CL is synthesized by condensation of phosphatidylglycerol with cytidine-5'-diphosphate-1,2-diacyl-sn-glycerol catalyzed by CL synthase [for review see ]. Thyroxine treatment of rats stimulated the expression of rat liver and heart mitochondrial CL synthase activities . The increase in CL synthase activity accounted for the elevated levels of CL observed in these organs. We recently identified and characterized the activity of monolysocardiolipin acyltransferase (MLCL AT), the enzyme responsible for monolysocardiolipin (MLCL) acylation to CL in mammalian tissues . In another study, we showed that thyroxine treatment of rats elevated cardiac MLCL AT activity and postulated that MLCL AT may be a rate-limiting enzyme for the molecular remodeling of CL in the heart . The above studies prompted us to examine if cardiac MLCL AT activity was linked to CL biosynthesis and content in the heart. Our results, using four different disease models in the rat in which the level of cardiac CL is either reduced, elevated or unaltered, demonstrate that this is the case. We also observe this relationship in a model of murine cardiac cell differentiation. Results : Cardiac CL content, CL synthase and MLCL AT activities are reduced in hypothyroid rats | In previous studies we observed that cardiac MLCL AT activity was elevated when the cardiac CL content and CL synthase activity were elevated in hyperthyroid rats . We examined if cardiac CL content, CL synthase and MLCL AT activities were reduced in hypothyroid rats. Rats were made hypothyroid by the addition of 0.05% PTU to their drinking water for 34 days. This protocol was shown to produce decreased serum thyroid hormone levels and result in cardiac atrophy in the rat . As seen in Table , in rats that received PTU there was a 48% decrease (p < 0.025) in heart weight compared to controls. In addition, the heart to body weight ratio decreased, indicative of cardiac atrophy. Growth failure was demonstrated by the decreased body weights of the hypothyroid animals compared to controls. As a further control, the activity of an inner mitochondrial membrane marker, succinate dehydrogenase, was determined. Cardiac mitochondrial succinate dehydrogenase activity was reduced 23% (p < 0.025) from 30 +- 3 mumol/minmg to 23 +- 3 mumol/minmg protein in PTU-treated rats. These are documented characteristics of hypothyroidism . Table 1 | Body weight, heart weight, heart CL content, CL synthase and MLCL AT activities in normal and hypothyroid rats. Heart mitochondrial fractions were prepared from rats made hypothyroid by the addition of 0.05% PTU to their drinking water for 34 days and CL content, CL synthase and MLCL AT activities determined. We initially determined the activity of cardiac mitochondrial PA:CTP cytidylyltransferase, a rate-limiting enzyme of CL biosynthesis . PA:CTP cytidylyltransferase activity was 15.1 +- 1.2 pmol/min/mg protein and unaltered (14.7 +- 1.1 pmol/min/mg protein) in cardiac mitochondrial fractions prepared from hypothyroid rats. Hence, PA:CTP cytidylyltransferase served as a control for a mitochondrial enzyme not affected by hypothyroidism. When compared to controls, heart mitochondria prepared from hypothyroid rats exhibited a 29% decrease (p < 0.025) in CL content, a 32% decrease (p < 0.025) in CL synthase activity and a 35% decrease (p < 0.025) in MLCL AT activity . PLA2 activity was 4.2 +- 0.7 nmol/minmg protein and unaltered (4.0 +- 0.5 nmol/minmg protein) in cardiac mitochondria prepared from hypothyroid rats. Thus, cardiac mitochondrial CL content, CL synthase and MLCL AT activities were all reduced in hypothyroid rats. Cardiac CL content, CL synthase and MLCL AT activities are unaltered in streptozotocin-induced diabetic rats and in hyperinsulinemic rats | Previously we showed that cardiac phosphatidylglycerol levels were reduced in streptozotocin-induced diabetic rats but CL synthase activity and CL content were unaltered . We examined if streptozotocin-induced diabetes in rats altered MLCL AT activity or if hyperinsulinemia in rats altered CL synthase and MLCL AT activities in cardiac mitochondria. Rats were made diabetic by injection of steptozotocin or hyperinsulinemic by intraperitoneal addition of insulin. Subsequently, the hearts were removed and mitochondrial fractions prepared. Cardiac CL synthase activities were 3.0 +- 0.5 pmol/minmg protein in hyperinsulinemic rats and did not differ from control (3.1 +- 0.6 pmol/minmg protein) non-insulin injected animals. Cardiac CL content was 5.9 +- 0.5 nmol/mg heart and unaltered compared to controls (6.1 +- 0.1 nmol/mg heart). Cardiac MLCL AT activities were 38 +- 6 pmol/minmg protein in diabetic rats and 43 +- 9 pmol/minmg protein in hyperinsulinemic rats and did not differ from controls (40 +- 6 pmol/minmg protein saline injected and 41 +- 9 pmol/minmg protein non-insulin injected animals, respectively). Thus, in streptozotocin-induced diabetes and hyperinsulinemia, conditions in which the CL content and CL synthase activities were unaltered, MLCL AT activity was unaltered. CL content, CL synthase and MLCL AT activities are unaltered during cardiac cell differentiation | As a distinct model, we examined if CL synthase activity was altered in murine P19 teratocarcinoma cells induced to undergo differentiation into cardiac myocytes. We chose this model since differentiation of murine P19 cells into cardiac myocytes results in an increase in phosphatidylethanolamine biosynthesis, phosphatidylethanolamine mass and lysophosphatidylethanolamine acyltransferase activities . The cells were harvested at various times, 0 --8 days post DMSO addition, and MRNA analysis of markers of cardiac cell differentiation performed on cell lysates. GATA-4 is a member of the GATA family of zinc finger transcription factors and is an early marker of cardiac cell differentiation. As seen in Figure , GATA-4 was expressed at 4 days post DMSO addition relative to the constitutive expression of tubulin. As expected GATA-4 expression preceded the expression of other cardiac genes including B-natriuretic peptide (BNP), alpha myosin heavy chain (alphaMHC), beta myosin heavy chain (betaMHC) and Troponin C relative to the constitutive expression of tubulin. Thus, the P19 cells used in this study differentiated into cardiac myocytes. As previously shown CL content, MLCL AT and PLA2 activities were unaltered during P19 cell differentiation into cardiac myocytes . CL synthase activity was 2.7 +- 0.5 pmol/minmg protein in undifferentiated and unaltered (2.8 +- 0.3 pmol/minmg protein) in differentiated P19 cells. Together, the above five models using hyper- and hypothyroid, diabetic and hyperinsulinemic rats and murine P19 cell differentiation into cardiac myocytes all indicate that expression of mammalian cardiac mitochondrial MLCL AT activity appears to be regulated in concert with the biosynthesis and content of CL in the heart. Figure 1 | Expression of genes during differentiation of P19 cells into cardiac myocytes. Expression of genes during differentiation of P19 cells into cardiac myocytes. P19 cells were incubated with 1% DMSO for up to 8 days. At various times, 0 --8 days post DMSO addition, cells were harvested and mRNA levels of GATA-4, BNP, alpha MHC, beta MHC, troponin C and tubulin were determined by quantitative RT-PCR analysis. Discussion : Previous and current studies in the mammalian heart and liver support the hypothesis that CL content is regulated in concert with the level of CL synthase activity | In the CL biosynthetic pathway, PG is converted to CL by condensation with CDP-DG catalyzed by CL synthase . In vitro studies have indicated that alteration in cellular CL levels appears to have functional consequences. For example, reduction in the content of CL was shown to reduce oxygen consumption in mitochondria prepared from rat liver . Thus, maintenance of the appropriate content of CL in mammalian mitochondria is essential for proper mitochondrial function. Thyroxine treatment of rats was shown to stimulate the activity of rat liver mitochondrial CL synthase 2.5-fold . This elevation in rat liver mitochondrial CL synthase activity was suggested to account for the elevated levels of CL observed in livers prepared from hyperthyroid rats. In addition, CL synthase was shown to be elevated in heart mitochondria prepared from hyperthyroid rats and this was correlated with an increase in cardiac CL content . Prior to the current study, CL synthase activity had not been determined in any model of hypothyroidism. Hypothyroidism in the rat resulted in a 25% reduction in cardiac CL synthase activity. This reduction in CL synthase activity likely accounted for the reduced levels of cardiac CL observed in hearts prepared from hypothyroid animals. Previous studies in the rat have indicated that hypothyroidism also results in reduced CL levels in the liver [for review see ]. Thus, it is reasonable to assume that CL synthase activity would also be reduced in the liver of hypothyroid animals. In the current study, CL synthase activity was unaltered in diabetic and hyperinsulinemic rats and in a model of murine cardiac cell differentiation. In these models, the content of CL was unaltered. These data suggest that the level of CL produced in the mammalian heart is regulated in concert with the level of CL synthase activity. Previous and current studies in the heart support the hypothesis that cardiac MLCL AT activity may be regulated in concert with CL content and CL synthase activity | The data presented in this paper are entirely consistent with the conclusion that the expression of MLCL AT activity in the heart is regulated in concert with the biosynthesis and content of cardiac CL. Previously, we demonstrated that thyroxine-treatment of rats resulted in an increase in cardiac CL content, CL synthase and MLCL AT activities . In the present study rats made hypothyroid with PTU in the drinking water had reduced cardiac CL content, CL synthase and MLCL AT activities. In contrast, in streptozotocin-induced diabetes and hyperinsulinemia, pathological conditions in which cardiac mitochondial CL content and CL synthase were unaltered , MLCL AT activities were unaltered. In addition, CL content, CL synthase and MLCL AT activities were unaltered during cardiac cell differentiation. It is reasonable to propose that when the rate of synthesis and level of CL is either reduced or elevated expression of the activities of the enzymes that remodel CL should be correspondingly reduced or elevated. The activity of cardiac mitochondrial PLA2 was high (100-fold) relative to cardiac mitochondrial MLCL AT activity and was unaltered in all models examined . Since MLCL AT activity was either increased or decreased under conditions in which elevated or reduced CL remodelling was required, i.e. elevated or reduced CL synthesis, it is possible that MLCL AT may be rate-limiting for MLCL acylation to CL in the mammalian heart. However, it should be considered that other factors such as the intra-mitochondrial level of MLCL may be limiting for the acylation of MLCL to CL. Conclusions : A summary of our findings is presented in Table . In hyperthyroidism, when cardiac CL synthase activity and CL content are elevated an increase in MLCL AT activity is observed. In hypothyroidism, when cardiac CL synthase activity and CL content are reduced a decrease in MLCL AT activity is observed. Finally, when cardiac CL synthase activity and CL content are unaltered in streptozotocin-induced diabetes, hyperinsulinemia and murine P19 cell differentiation into cardiac myocytes, MLCL AT activity is unaltered. Thus, expression of MLCL AT activity is regulated in concert with the biosynthesis and content of cardiac CL. Table 2 | Summary of mammalian cardiac mitochondrial MLCL AT activities, CL synthase activities and CL content in various cardiac models. Materials and Methods : Male Sprague Dawley rats (125 --175 g) were used throughout the study and were housed in a temperature and light controlled room. They were maintained on Purina rat chow and tap water ad libitium. Treatment of animals conformed to the Guidelines of the Canadian Council on Animal Care. Rats were made hypothyroid by administration of (0.5% w/v) 6-n-propyl-2-thiouracil (PTU) in their drinking water for 34 days. Rats were made diabetic by injection of 60 mg/Kg steptozotocin. Hyperglycemia was confirmed 24 h later by urine and blood glucose analysis. Rats were made hyperinsulinemic by intraperitoneal addition of 3 units/day of insulin for 28 days. Murine P19 teratocarcinoma cells were kindly provided by Dr. Mona Nemer, Institute of Cardiovascular Research, University of Montreal, Montreal, Quebec, Canada. [1-14C]Linoleoyl-Coenzyme A was obtained from American Radiochemical Co., St. Louis MO. All other radiochemicals were obtained from Dupont, Winnipeg, Canada. MLCL was obtained from Avanti Polar Lipids, Alabaster, AL. Thin-layer chromatography (Silica gel 60, 0.25 mm thickness) plates were obtained from BDH, Toronto, Canada. Cell culture and reagents were products of Canadian Life Technologies (GIBCO) Burlington, Ontario, Canada. Ecolite scintillant was obtained from ICN Biochemicals, Costa Mesa, CA.. Lipids standards were obtained from Serdary Research Laboratories, Englewood Cliffs, NJ., USA. All other biochemicals were of analytical grade and obtained from either Fisher Scientific, Edmonton, Canada, Sigma Chemical Co., St. Louis, MO. or CanLab Division of Baxter Co. Winnipeg, Canada. The protocol for differentiation and culturing of murine P19 teratocarcinoma cells into cardiac myocytes was performed as described . P19 cells (5 x 105 cells/ml) were placed into 60 mm bacterial dishes, 1% dimethylsulfoxide (DMSO) was added and incubation continued for 48 h. The cells began to aggregate at this point. Cells were then transferred to a 100 mm bacterial dish and 1% DMSO was added for another 48 h. The cells in these 100 mm bacterial dishes differentiated into the cardiac cell lineage within eight days. At various days (0 --8) post DMSO addition cells were harvested and mRNA expression of GATA-4, BNP, alphaMHC, betaMHC, troponin C and tubulin were determined using quantitative RT-PCR analysis as described . A 10% homogenate from rat hearts or P19 cells was prepared in buffer (0.25 M sucrose, 0.145 M NaCl, 10 mM Tris-HCl, pH 7.4) and centrifuged for 10 min at 600 x g (Beckman J2-H with JA-20 rotor). The resulting pellet was washed once, resuspended in 5 ml buffer by 15 strokes of a hand-held Dounce (tight fitting) tissue grinder and designated the crude nuclear fraction. The supernatant from the first centrifugation was centrifuged at 10,000 x g for 10 min. The resulting pellet was resuspended in 1.5 ml buffer as described above and used as the source of mitochondrial fraction for enzyme assays. Protein in this fraction was determined by the method of Bradford . Phospholipase A2 (PLA2) was determined as described using phosphatidyl [14C]glycerol as substrate . CL synthase and phosphatidic acid (PA):CTP cytidylyltransferase activities were determined as described . MLCL AT activities were determined as described . Mitochondrial fractions (50 mug) were incubated for 30 min at 25C in 50 mM Tris-HCL, pH 8.0, 33 muM [1-14C]linoleoyl-Coenzyme A (68,700 dpm/nmol), 0.3 mM MLCL in a final volume of 0.35 ml. The reaction was initiated by the addition of [1-14C]linoleoyl-Coenzyme A substrate and terminated by addition of 3 ml of chloroform:methanol (2:1, by vol). 0.8 ml of KCL was added to facilitate phase separation. The aqueous phase was removed and the organic phase dried under nitrogen and resuspended in 25 mul of chloroform:methanol (2:1, by vol). A 20 mul aliquot was placed on a thin layer plate and CL was separated from other phospholipids in a solvent system containing chloroform:hexane:methanol:acetic acid (50:30:10:5, by vol). The silica gel corresponding to CL was removed and placed in plastic scintillation vials with 5 ml of aqueous counting scintillant. Radioactivity incorporated into CL was determined approximately 24 h later using a liquid scintillation counter. CL content was determined as described . Mitochondrial succinate dehydrogenase activity was determined as described . Students t-test was used for the determination of statistical significance. The level of significance was defined as p < 0.025. List of abbreviations : CL, Cardiolipin; MLCL AT, monolysocardiolipin acyltransferase; MLCL, monolysocardiolipin; PTU, 6-n-propyl-2-thiouracil; PLA2, phospholipase A2; PA, phosphatidic acid; DMSO, dimethylsulfoxide; CTP, cytidine-5'-triphosphate; ATP, adenosine-5'-triphosphate; ADP, adenosine-5'-diphosphate; BNP, B-natriuretic peptide; alphaMHC, alpha myosin heavy chain; betaMHC, beta myosin heavy chain; mRNA, messenger ribonucleic acid; STZ, Stre ptozotocin Authors contribution : Mr. William A. Taylor intitiated the experimental and edited the manuscript. Dr. Fred Y. Xu performed experimental studies related to the P19 cells and edited the manuscript. Mr. Brian J. Ma performed experimental studies related to the hyperinsulinemic rat model and edited the manuscript. Dr. Thomas C. Mutter performed experimental studies related to the hypothyroid rat model. Mr. Vernon W. Dolinsky initiated experimental studies related to the hypothyroid rat model and edited the manuscript. Prof. Grant M. Hatch conceived of the study, participated in its design and coordination, wrote and edited the manuscript. All authors have read and approved the final manuscript. Backmatter: PMID- 12052259 TI - The role of the Zn(II) binding domain in the mechanism of E. coli DNA topoisomerase I AB - Abstract | Background | Escherichia coli DNA topoisomerase I binds three Zn(II) with three tetracysteine motifs which, together with the 14 kDa C-terminal region, form a 30 kDa DNA binding domain (ZD domain). The 67 kDa N-terminal domain (Top67) has the active site tyrosine for DNA cleavage but cannot relax negatively supercoiled DNA. We analyzed the role of the ZD domain in the enzyme mechanism. Results | Addition of purified ZD domain to Top67 partially restored the relaxation activity, demonstrating that covalent linkage between the two domains is not necessary for removal of negative supercoils from DNA. The two domains had similar affinities to ssDNA. However, only Top67 could bind dsDNA with high affinity. DNA cleavage assays showed that the Top67 had the same sequence and structure selectivity for DNA cleavage as the intact enzyme. DNA rejoining also did not require the presence of the ZD domain. Conclusions | We propose that during relaxation of negatively supercoiled DNA, Top67 by itself can position the active site tyrosine near the junction of double-stranded and single-stranded DNA for cleavage. However, the interaction of the ZD domain with the passing single-strand of DNA, coupled with enzyme conformational change, is needed for removal of negative supercoils. Keywords: Background : Escherichia coli DNA topoisomerase I is a representative example of type IA DNA topoisomerase (for reviews, see refs ). Its major biological role in the bacterial cell is the removal of excessive negative supercoils from DNA to maintain the DNA at optimal superhelical density along with DNA gyrase . The enzyme has a molecular weight of 97 kDa and the active site tyrosine responsible for DNA cleavage is found in the 67 kDa N-terminal transesterification domain. The structure of this 67 kDa domain has been determined by X-ray crystallography to be torus-like, indicating the need for protein conformational change for strand passage to take place after DNA cleavage . Relaxation activity requires the presence of the Zn(II) binding tetracysteine motifs found between the 67 kDa N-terminal domain (Top67) and the 14 kDa C-terminal single-stranded DNA binding domain . The three tetracysteine motifs do not form a stably folded structure on its own, but when combined with the 14 kDa C-terminal domain, forms a stably folded 268 amino acid DNA binding domain (ZD domain) that has higher affinity for single-stranded DNA than the 121 amino acid 14 kDa C-terminal region by itself . Recent sequence and structural analysis suggests that the 14 kDa domain is evolutionarily related to the three tetracysteine motifs and belongs to the zinc ribbon family . The ZD domain in E. coli topoisomerase I probably evolved from a domain that binds five Zn(II) originally. Figure 1 | Domain organization of E. coli DNA topoisomerase I. Domain organization of E. coli DNA topoisomerase I. Removal of negative supercoils from DNA by bacterial type IA topoisomerase involves the following steps: (1) binding of the enzyme to the junction of double-stranded and single-stranded DNA ; (2) cleavage of a single-strand of DNA near the junction with cleavage sequence preference of a cytosine in the -4 position to form the covalent intermediate ; (3) conformational change of the covalent enzyme-DNA complex to result in physical separation of the 5' phosphate covalently linked to the active tyrosine, and the 3' hydroxyl of the cleaved DNA; (4) passage of the complementary single strand through the break; (5) enzyme conformational change to bring the 5' phosphoryl end back into the proximity of the 3' hydroxyl group of the cleaved DNA; (6) religation of the phosphodiester bond. Although it is known that the ZD domain can function as a DNA binding domain, its exact role in these individual steps of removal of a negative superhelical turn from DNA by E. coli topoisomerase I remains to be defined. Using purified 67 kDa transesterification domain and 30 kDa ZD domain, results from experiments described here provide new insight into the action of these two individual domains in the enzyme mechanism. Results : Partial restoration of relaxation activity from mixing of Top67 and ZD domains | As reported previously , the N-terminal transesterification domain Top67 by itself did not exhibit any relaxation activity when assayed with negatively supercoiled plasmid DNA . The 30 kD C-terminal ZD domain also had no relaxation activity by itself, as expected. Partial relaxation of the input supercoiled DNA was detected when Top67 was mixed with the ZD domain prior to addition of DNA. A ratio of 2 ZD molecules added for each Top67 was found to be sufficient for maximum relaxation activity, with no increase in activity when higher ratio of ZD/Top67 was used (data not shown). The specific activity observed under this optimized condition was still about 10 fold lower than that of the intact enzyme. Analysis of the time course of relaxation with 6 pmoles of topoisomerase I or top67 reconstituted with ZD showed that negative supercoils were removed at a much slower rate by the reconstituted activity. Figure 2 | Partial restoration of relaxation activity by complementation of Top67 and ZD domains. Partial restoration of relaxation activity by complementation of Top67 and ZD domains. (a). Agarose gel electrophoresis was carried out to analyze the relaxation reaction products after 1 h of incubation. Lane 1: supercoiled plasmid DNA with no protein added; lane 2: Top67 alone; lane 3: ZD alone. Lanes 4 --7 (Top67 reconstituted with ZD) and lanes 8 --11 (topoisomerase I) have 6, 1.2, 0.24 and 0.05 pmoles of proteins added. (b). Time course of relaxation reaction catalyzed by 6 pmoles of topoisomerase I, or Top67 reconstituted with ZD Top67 and ZD domains have comparable binding affinities to single-stranded DNA but significantly different affinities for double-stranded DNA | The gel mobility shift assay was used to compare the binding affinities of Top67 and the ZD domain to a 5' end-labeled single-stranded oligonucleotide 35 base in length. As shown in Figure , these two domains had similar affinities for binding to the single-stranded substrate. The half maximal binding values based on the average of results from three different experiments were 0.02 muM for Top67 and 0.04 muM for the ZD domain. However, with the same oligonucleotide in a duplex form , Top67 exhibited much higher affinity (half maximal binding value = 0.07 muM) than the ZD domain (half maximal binding value > 5 muM). Figure 3 | Binding of Top67 and ZD to single-stranded and double-stranded DNA. Binding of Top67 and ZD to single-stranded and double-stranded DNA. The gel mobility shift assay was used to compare the binding affinities. The substrates used are (a): single-stranded 5'GAAAACTCACAGGAAGCGGCCGAAGCGATTCGTCC 3'; (b): the same labeled strand of hybridized to its complementary strand. Open circles: Top67; solid circles: ZD. Top67 can recognize cleavage sites preferred by E. coli DNA topoisomerase I | Previous studies have shown that E. coli DNA topoisomerase I cleavage of single-stranded DNA occurs with selectivity for sites with the C nucleotide base at the -- 4 position and that the enzyme preferentially cleaves at junctions of double-stranded and single-stranded DNA . Several different 5'-end labeled substrates were prepared and used in cleavage assays to compare the cleavage sites selected by Top67 versus topoisomerase I. The results showed that with single-stranded substrates, Top67 also preferred cleavage sites with a C nucleotide base at the -4 position as reported for most of the type IA topoisomerases . There were some differences from topoisomerase I in the relative distribution of cleavage products among the potential cleavage sites . Top67 appeared to be more non-discriminatory in selection of the possible cleavage sites with the C nucleotide in the -4 position. Addition of the ZD domain had no effect on the cleavage selectivity of Top67. A substrate with both single-stranded and double-stranded regions was constructed to mimic such junction in negatively supercoiled DNA. Top67 and topoisomerase I recognised the same cleavage site on this substrate . Maximal yield of cleavage products was obtained for both Top67 and topoisomerase I within seconds after mixing of the enzyme and DNA so any potential difference in cleavage rates between the Top67 and topoisomerase I is unlikely to account for the difference in relaxation efficiency. Figure 4 | Cleavage selectivity of topoisomerase I and Top67. Cleavage selectivity of topoisomerase I and Top67. This was analyzed using single-stranded 32mer (a), 31mer (b), or substrate with both single- and double-stranded regions (c). For (a) and (b), lane 1: no protein added, lane 2: topoisomerase I, lane 3: Top67, lane 4: Top67 mixed with ZD. For (a), lane 5: ZD alone. For (c), lane 1: topoiosmerase I, lane 2: Top67, lane 3: no protein added, lane 4: DNase I digestion pattern. Top67 cleavage sites are religated upon addition of high salt and Mg2+ | To test the religation capability of Top67, a 5'-end labeled oligonucleotide 61 base in length was first incubated with the enzyme in low ionic strength buffer to allow formation of the cleaved complex. Sodium chloride concentration was then increased to 1 M to induce reversal of cleavage and dissociation of the enzyme from the DNA. We observed that more complete and consistent reversal of cleavage was obtained with both topoisomerase I and Top67 if a low concentration of Mg2+ (4 mM) was also added with the NaCl. This is consistent with an early observation of dissociation of the enzyme-DNA complex in high salt upon addition of Mg2+. It has also been reported that addition of Mg2+ was apparently not required for observation of this reversal of cleavage. However, it is possible that some enzyme preparations may contain bound Mg2+ and the low concentration of bound Mg2+ might have been sufficient for reversal of cleavage, as postulated previously to explain the data . The results of this cleavage reversal experiment indicated that the ZD domain was not required for efficient reversal of cleavage and Top67 could carry out religation of cleaved DNA. Again the reversal of cleavage was complete for both Top67 and topoisomerase I within seconds after the addition of high salt and Mg2+ even when the reactions were carried out on ice (data not shown) so the lack of relaxation activity by Top67 is unlikely to be due to deficiency in religation. Figure 5 | Reversal of DNA cleavage by topoisomerase I and Top67. Reversal of DNA cleavage by topoisomerase I and Top67. A 5'-end labeled 61mer was used as substrate. C: no enzyme added. Lane 1: enzyme cleavage reaction stopped with SDS; Lane 2: enzyme cleavage reaction incubated with 1 M NaCl before SDS treatment; Lane 3: enzyme cleavage reaction incubated with 1 M NaCl and 4 mM MgCl2 before SDS treatment. The ZD domain is not required for catenation of double-stranded DNA circles | E. coli topoisomerase I can catalyze catenation of double-stranded DNA circles if the molecules contain single-strand scissions . To test if the Top67 can carry out double-stranded DNA passage at enzyme cleavage sites across from the DNA nicks, the yield of DNA catenanes were compared with that obtained with topoisomerase I. In contrast to the relaxation activity, the catenating activity of Top67 shown in figure was as efficient as that of full-length topoisomerase I, and the addition of the ZD domain had no effect . The rate of catenane formation for Top67 alone was similar to that of topoisomerase I . This catenation activity observed with topoisomerase I and Top67 was unlikely to be due to contaminating topoisomerase III activity since it was not observed with the ZD domain purified under almost identical procedures and a site-directed mutant with substitution of the active site Tyr319 by phenylalanine also did not exhibit this activity . Figure 6 | Catenation of nicked double-stranded DNA circles by topoisomerase I and Top67. Catenation of nicked double-stranded DNA circles by topoisomerase I and Top67. (a). Phage PM2 DNA circles with one or more single-strand scissions were incubated with 5 pmoles of proteins for 1 h. Lane 1: no enzyme added; Lane 2: topoisomerase I; Lane3: Top67; Lane 4: Top67 and ZD domain; Lane 5: ZD domain; Lane 6: mutant with Y319F substitution. (b). Aliquots of the reaction for topoisomerase I and Top67 were removed at different time points to analyse the time course of catenation. Discussion : There are two homologous type IA topoisomerases present in E. coli. Topoisomerase III has potent DNA decatenating activity for resolution of plasmid DNA replication intermediates, but much weaker relaxation activity than topoisomerase I . To exhibit maximal relaxation activity, topoisomerase III requires high temperature (52C) along with low magnesium and monovalent ion . In contrast, E. coli topoisomerase I was not active in the in vitro assay for resolution of plasmid DNA replication intermediates . Removal of the C-terminal 49 amino acids from the 653 amino acid topoisomerase III protein resulted in drastic reduction of catalytic activity . Fusion of the carboxyl-terminal 312 amino acid residues of E. coli topoisomerase I, which includes the entire ZD domain, onto the 605 N-terminal amino acids of topoisomerase III generated a hybrid topoisomerase that has relaxation activity resembling topoisomerase III along with weak decatenating activity . Although preferring single-stranded DNA as binding substrate, topoisomerase I had been shown to also bind double-stranded DNA , but there is no data available to indicate which domain in the enzyme is responsible for this interaction. The experiments described here measured directly the interaction of the ZD domain with both double-stranded and single-stranded DNA substrates. ZD domain was found to bind to single-stranded DNA, but not double-stranded DNA, with high affinity. This result indicated that with regard to the mechanism of E. coli topoisomerase I, the ZD domain was likely to function as a single-stranded DNA binding domain instead of having double-stranded DNA binding function as previously suggested . Even though Zn(II) binding transcription factors that recognise specific double-stranded DNA are well represented in eukaryotes , there are also numerous examples of Zn(II) coordination being required for interaction with single-stranded nucleic acid or damaged DNA with single-strand characteristics . The effect of removal of the ZD domain on the individual step of enzyme action was also investigated using Top67. The results indicated that Top67 was effective in binding to both double-stranded and single-stranded DNA. As a result, Top67 could position itself in the absence of ZD domain at the junction of double- and single-stranded DNA for subsequent DNA cleavage, as previously observed for intact topoisomerase I . Reversal of DNA cleavage also took place readily with Top67 upon addition of 1 M NaCl and 4 mM MgCl2. The ZD domain also was not required for selectivity of a cytosine in the -4 position relative to the cleavage sites. Despite its ability to recognise the DNA substrate and carry out DNA cleavage-religation, Top67 by itself cannot catalyze change of linking number in the relaxation of supercoiled DNA. The single-strand DNA substrate designated for the ZD domain in the catalytic mechanism of the enzyme may be the strand of DNA complementary to the strand first cleaved by the enzyme to form the covalent complex. This interaction with the passing strand of DNA would not be needed for the first two steps of enzyme mechanism up to the formation of the covalent complex. Our results showed that adding the purified ZD domain partially restored the relaxation activity. Therefore the ZD domain can supply the function that is missing in Top67 even when the two domains are not covalently linked. However, the resulting relaxation activity is much less efficient than that of the intact enzyme, suggesting that coordinated actions of the two domains are required for efficient removal of negative supercoils from DNA. The requirement of specific protein-protein interactions between the two domains could also account for the weak relaxation activity observed for the hybrid topoisomerase with ZD linked to topoisomerase III sequence . This proposed role for the ZD domain in interacting with the passing single-strand of DNA is also supported by the observation that there is no difference between Top67 and intact topoisomerase I in the formation of catenanes. This reaction involves passage of another double-stranded DNA circle, instead of the complementary DNA strand through the break generated by DNA cleavage so the ZD domain would not be expected to play any significant role. High concentration of DNA substrate is required to favor formation of catenanes catalyzed by topoisomerase I, and the enzyme also has to be present in higher concentration compared to the relaxation reaction. The double-stranded DNA-binding activity in E. coli topoisomerase III required for highly efficient decatenation activity is attributed to a 17-amino-acid residue with no counterpart in E. coli topoisomerase I . It may be required for interaction with the passing double-strand of DNA in the decatenation mechanism. The presence of this decatenation loop instead of the Zn(II) binding ZD domain in topoisomerase III may account for the dominance of the decatenation activity over the relaxation activity. Based on these results, we propose a model for the relaxation of supercoiled DNA by E. coli topoisomerase I modified from previous versions that have a number of common features but differ most significantly in the role of the Zn(II) binding domain . In this model, the subdomains in Top67 is responsible for interacting with the G-strand of DNA both upstream and downstream of the cleavage site. The ZD domain interacts with the passing single-strand DNA to be transported (T-strand). After cleavage of the DNA gate strand which becomes covalently linked to Tyr319 on Top67 (step 2), protein conformational change involving both Top67 and the ZD domain increases the distance between the covalently bound 5' phosphate and non-covalently bound 3' hydroxyl of the cleaved DNA gate strand while the passing DNA strand (T-strand) is guided through the "gate" via interaction with the ZD domain (step 3) to lead to change in linking number. A second enzyme conformational change positions the cleaved DNA ends for religation (step 4). The ZD domain can still interact with the T-strand of DNA even when not linked to Top67 in the same polypeptide, but efficiency of catalysis is reduced as a result, probably due to loss of coordinated action by the two domains. The presence of the ZD domain may enhance the transition of Top67 from a closed conformation to a more open conformation so that strand passage can take place through the "DNA gate". Previous data showed that although Zn(II) binding is not absolutely required for formation of the cleaved complex, it increased the amount of cleaved complex that can be isolated . When linked to Top67, the ZD domain also has some influence on the cleavage site selections. It has previously been observed that a mutation in the Zn(II) binding motif can affect the cleavage site selectivity of topoisomerase I even though Top67 by itself can recognize both the cytosine in the -4 position and the junction of single- and double-stranded DNA. To gain further details for this model of enzyme action, we are characterizing the protein-protein interactions between the Top67 transesterification domain and the ZD domain, as well as the protein conformational changes that can take place when the enzyme interacts with DNA substrate. Figure 7 | Model for removal of a negative supercoil by E. coli DNA topoisomerase I. Model for removal of a negative supercoil by E. coli DNA topoisomerase I. Subdomains I, II, III, IV found in the crystal structure of Top67 (4) are illustrated schematically along with the potential site for ZD domain (Z). G-strand: DNA strand cleaved to provide "DNA Gate". T-strand: DNA strand to be transported through the "DNA Gate". The hyperthermophilic topoisomerase I from Thermotoga maritima has been shown to coordinate one Zn(II) with a unique tetracysteine motif Cys-X-Cys-X16-Cys-X-Cys but Zn(II) binding is not required for relaxation activity . The sequence of this unique tetracysteine motifs is somewhat different from those present in other type IA topoisomerases in that the other tetracysteine motifs always had at least two amino acids separating the pairs of cysteines (Cys-X2-11-Cys), instead of just one amino acid (Cys-X-Cys) in T. maritima topoisomerase I . Therefore the structure and function of the single Zn(II) binding motif in T. maritima may differ from the multiple Zn(II) binding motifs in E. coli topoisomerase I. Direct interaction between DNA and the T. maritima Zn(II) binding motif has not been demonstrated. It has been suggested that the mechanisms of these two enzymes may be different . Direct interaction between the enzyme and the passing strand may not be necessary for the T. maritima topoisomerase I activity. The relaxation and decatenation activities of T. maritima topoisomerase I appear to be significantly more efficient than those of the E. coli topoisomerase I . Based on their primary sequences, a number of bacterial topoisomerase I enzymes do not appear to coordinate any Zn(II) with tetracysteines motifs while other type IA topoisomerase has up to 4 tetracysteine motifs . The topoisomerase I from Mycobacterium smegmatis has been demonstrated biochemically not to bind Zn(II) . In contrast, mutation disrupting the fourth Zn(II) motif of Helicobacter pylori topoisomerase I abolished enzyme function in vivo. Therefore there may be significant differences in the mechanisms of type IA topoisomerases from different organisms with respect to requirement of Zn(II) binding for relaxation activity. There is also another possible explanation for the varied number of tetracysteine motifs and requirement of Zn(II) for relaxation activity found in different type IA topoisomerases. The 14 kDa C-terminal region of E. coli topoisomerase I has been classified based on its structure to be in the Zn-ribbon superfamily [SCOP release 1.50, 7] even though it does not bind Zn(II). It also has high affinity for binding to single-stranded DNA on its own when separated from the three tetracysteine motifs . Based on the structural and DNA-binding properties of the E. coli topoisomerase I 14 kDa domain, one can conclude that it is possible for a subdomain in topoisomerase I to lose the Zn(II) binding cysteines during evolution and still maintains the Zn-ribbon structure and single-strand DNA binding properties . Finally, the in vivo catalytic activities of eukarytotic type IA topoisomerases, the topoisomerase III from various higher organisms may be related to their sequences. The transesterification domains of these eukaryotic enzymes have high degrees of identity to E. coli DNA topoisomerase III . However, the decatenation loop is not present in the eukaryotic topoisomerase III sequences and to date the decatenation activity has not been demonstrated for these enzymes. The number of potential Zn(II) binding cysteine motifs range from none in S. cerevisiae DNA topoisomerase III to four highly conserved tetracysteine motifs in the beta family of the topoisomerase III enzymes . The Zn(II) domain formed by these tetracysteine motifs may be required for interaction with single-strand DNA in removal of hypernegative supercoils or disruption of early recombination intermediates between inappropriately paired DNA molecules . Conclusions : We have shown that the ZD domain of E. coli DNA topoisomerase I is not required for the substrate recognition and DNA cleavage-religation action of the enzyme. We propose that the ZD domain interacts with the passing single-strand of DNA in the relaxation of negatively supercoiled DNA by this enzyme. Materials and methods : Enzyme and DNA | E. coli DNA topoisomerase I and the ZD domain were expressed and purified as described . To express the 67 kDa N-terminal transesterification domain (Top67), a stop codon at amino acid 598 was introduced into plasmid pJW312 used for topoisomerase I expression by site-directed mutagenesis employing the Chameleon-Mutagenesis kit from Stratagene. Top67 was expressed and purified with the same procedures as topoisomerase I. The oligonucleotides were custom synthesized by Genosys. The single-strand substrates and the top strand of the duplex substrates were labeled at the 5' termini with T4 polynucleotide kinase and gamma32P-ATP. The labeled oligonucleotides were purified by electrophoresis in a 12 or 15% sequencing gel. After elution from the gel slice, the labeled single-stranded oligonucleotides were desalted by centrifugation through a Sephadex G10 spin column. The duplex or heteroduplex substrates were prepared by mixing the labeled top strand with 4 fold excess of the unlabeled bottom strand, heating at 80C for three minutes, cooling to room temperature and purified by electrophoresis in a 20% non-denaturing polyacrylamide gel with TBE buffer. Plasmid pJW312 DNA used in relaxation assay was purified by CsCl centrifugation. Phage PM2 DNA was extracted from infected Pseudoalteromonas espejiana cells and PM2 DNA with one or more single-chain scissions used in the catenation assay was prepared as described . DNA relaxation assay | Top67 and the ZD domains at different concentrations were mixed and incubated at 37C for 10 min before addition to the 0.3 mug of supercoiled plasmid DNA in 20 mul of 10 mM Tris-HCl pH 8.0, 2 mM MgCl2, 0.1 mg/ml gelatin. After incubation at 37C for up to 1 h, the reaction was stopped by addition of 50 mM EDTA and electrophoresed in a 0.7% agarose gel and visualized by ethidium bromide staining as described . Gel mobility shift assay | The proteins were mixed with the 1 pmole of the labeled DNA substrates in 10 mul of 20 mM Tris-HCl pH 8.0, 100 mug/ml BSA, 12% glycerol and 0.5 mM EDTA. The samples were incubated at 37C for 5 min and then loaded onto a 6% polyacrylamide gel and electrophoresed with buffer of 45 mM Tris-borate pH 8.3, 1 mM EDTA. Electrophoresis was carried out at room temperature at 2 V/cm for 2 h. After drying of the gel, bands corresponding to the protein-bound oligonucleotides and unbound oligonucleotides were visualized by autoradiography, excised and counted in a Scintillation counter for quantitation. DNA cleavage assay | The cleavage assays were carried out with 1 pmole of 5' 32P-end labeled DNA substrate and 5 --10 pmoles of topoisomerase I or Top67 in 10 mul of the buffer used for the gel mobility shift assay. After incubation at 37C for up to 20 min, an equal volume of 90% formamide, 10 mM KOH, 0.25% bromophenol blue and 0.25% xylene cyanol was added to stop the reactions. The samples were analyzed by electrophoresis in a 12% sequencing gel followed by autoradiography. Salt and Mg2+ induced reversal of cleavage | The conditions were modified from those described previously . The cleavage reactions were incubated at 37C for 5 min and then divided into three aliquots. The cleavage products were trapped in one aliquot by the addition of SDS to 1%. NaCl (1 M) alone or NaCl with MgCl2 (4 mM) were added to the other aliquots followed by further incubation at 37C for up to 30 min before the addition of SDS. The products were analyzed as described for the cleavage reactions. Catenation of nicked DNA circles | The catenation reaction was carried out with 1.4 mug of nicked PM2 phage DNA in 20 mul of 10 mM Tris-HCl, pH 8.0, 0.1 mM EDTA, 10 mM KCl, 10 mM MgCl2. After incubation at 37C for up to1 h, the reactions were stopped with the addition of 1% SDS and 50 mM EDTA. The products were analyzed as described for the relaxation assay. Authors' contributions : Author 1 (A.A.) carried out all the experiments except the catenation assay. Author 2 (Y.T.) conceived of the study, participated in its design and coordination and carried out the catenation assay. All authors read and approved the final manuscript. Backmatter: PMID- 11996675 TI - Hisactophilin is involved in osmoprotection in Dictyostelium AB - Abstract | Background | Dictyostelium cells exhibit an unusual stress response as they protect themselves against hyperosmotic stress. Cytoskeletal proteins are recruited from the cytosolic pool to the cell cortex, thereby reinforcing it. In order to gain more insight into the osmoprotective mechanisms of this amoeba, we used 1-D and 2-D gel electrophoresis to identify new proteins that are translocated during osmotic shock. Results | We identified hisactophilin as one of the proteins that are enriched in the cytoskeletal fraction during osmotic shock. In mutants lacking hisactophilin, viability is reduced under hyperosmotic stress conditions. In wild type cells, serine phosphorylation of hisactophilin was specifically induced by hypertonicity, but not when other stress conditions were imposed on cells. The phosphorylation kinetics reveals a slow accumulation of phosphorylated hisactophilin from 20 --60 min after onset of the hyperosmotic shock condition. Conclusion | In the present study, we identified hisactophilin as an essential protein for the osmoprotection of Dictyostelium cells. The observed phosphorylation kinetics suggest that hisactophilin regulation is involved in long-term osmoprotection and that phosphorylation occurs in parallel with inactivation of the dynamic actin cytoskeleton. Keywords: Background : Cells steadily face changes of the external osmolarity, to which they have to adapt. To withstand a steep increase in osmolarity, eukaryotic cells activate responses like "regulatory volume increase", accumulation of compatible osmolytes and stimulated expression of stress proteins . Recently, an exception from this scheme has been identified: Dictyostelium cells protect themselves against hyperosmolarity by largely rearranging cellular proteins, whereas no "regulatory volume increase", no accumulation of compatible osmolytes and no change of the expression pattern of the most abundant proteins were observed . Among the translocated proteins identified, cytoskeletal proteins appear to be predominant. In particular, the rearrangement of actin and myosin II to the cell cortex beneath the plasma membrane was shown to constitute a pivotal element of osmoprotection in Dictyostelium. These two proteins form the core of a rigid network resembling a shell-like structure . Conversely, DdLIM, a cytoskeletal protein involved in the formation of protrusions , is depleted from the cytoskeletal fraction under hypertonic conditions, which is in consistence with the rounding up and the retraction of protrusions of cells . 30 --60 min after onset of the shock condition, progressive actin phosphorylation is observed , which presumably leads to the inactivation of the dynamic actin system . The pivotal role of the cytoskeleton in hyperosmotic stress response is also reflected by the fact, that the cytoskeletal proteins beta-actinin and "120 kDa gelation factor" are essential to ensure survival under hyperosmotic conditions . However, the signalling pathways mediating protein translocation and actin phosphorylation largely remain to be elucidated. The best understood signalling pathway involves myosin II translocation: upon hyperosmotic stress an increase in cGMP concentration was observed, which is due to guanylyl cyclase activation. This in turn results in the activation of the kinase, which eventually phosphorylates myosin II heavy chain . Thereby, disassembly of myosin II filaments is induced as a prerequisite for their reassembly at the cell cortex , which is accomplished within 10 min after onset of hyperosmotic shock . In addition, DokA, a homologue of bacterial histidine kinases and cAMP are involved in hyperosmolar signal transduction , however, molecular targets of these signalling pathways during osmoregulation have not been identified yet. Hence, the translocation and phosphorylation of cytoskeletal proteins constitute pivotal osmo-responses in Dictyostelium. To further elucidate this unusual hyperosmolar stress response we attempted to identify additional proteins, which are translocated under hypertonic conditions and investigated, whether protein phosphorylation of a candidate protein is regulated in response to hyperosmolarity. We could identify hisactophilin as such a protein, which is translocated and phosphorylated during hyperosmotic shock. Hisactophilin is a 15 kDa protein in Dictyostelium, that consists of two highly identical isoforms Hisactophilin I and II, which are myristoylated at the N-terminus . The two isoforms exhibit 84% sequence identity and are both myristoylated and distributed between plasma membrane and cytoplasm . Due to this high degree similarity, both isoforms are in this manuscript referred to as hisactophilin, without distinguishing between them. The biochemical properties of hisactophilin, namely actin- and membrane binding have recently shown to be strongly pH-dependent, which is due to the high content of 26 --30% histidine residues . Therefore, a role also as pH-sensor was postulated for this protein . In addition to myristoylation, phosphorylation was shown to be a posttranslational modification of hisactophilin ; the physiological role of hisactophilin phosphorylation however is unknown. Hisactophilin appears to play an essential role in osmoprotection, as hisactophilin null cells are osmosensitive. Results : Hisactophilin is enriched in the cytoskeletal fraction of wild type cells exposed to hyperosmotic shock | To identify proteins, which are translocated to or depleted from the cytoskeleton upon hyperosmotic stress, we used 2-D electrophoresis as a differential method. Wild type cells were subject to hypertonic shock in liquid culture prior to cell lysis. The Triton X-100-insoluble cytoskeletal fraction was isolated and the proteins were separated by 2-D electrophoresis. Samples from three independently grown cell cultures were analyzed in parallel. As control, the same procedure was performed with wild type cells shaken in SPB buffer. Computer analysis of the silver-stained gels with the software package Melani II (Biorad) revealed, that a 15 kDa protein, consisting of several isoforms with a pI of 7.3 --7.5, is enriched in the cytoskeletal fraction of hyperosmotically shocked cells compared to control cells (a typical result is shown in Fig. , upper panels). Correspondingly, reduction of the protein amount in the cytosolic pool was observed under hypertonic conditions compared to the control (Fig. , lower panels), suggesting, that the protein is translocated from the cytosol to the cytoskeleton under hypertonic conditions. Search of protein databases for Dictyostelium proteins exhibiting a molecular weight of 15 kDa and a pI of 7.3 --7.5 resulted in hisactophilin as a candidate cytoskeletal protein, which consists of two isoforms, hisactophilin I and II . The identity of the characterized protein as hisactophilin was demonstrated by immunostaining with a monoclonal alpha-hisactophilin antibody . In addition, analysis of digested peptides of the protein eluted from 2-D gels by mass spectrometry demonstrated the identity of hisactophilin (data not shown). The enrichment of hisactophilin in the cytoskeletal fraction of hyperosmotically shocked cells was also confirmed by analyzing cytoskeletal fractions by 1-D SDS-PAGE followed by immunostaining with an alpha-hisactophilin antibody . As the actin-rich cytoskeleton is primarily found in the cell cortex of hypertonically shocked cells , we investigated, whether a hisactophilin II-GFP fusion protein expressed in wild type cells is translocated to the cell cortex after onset of hyperosmotic shock. In fact, the hisactophilin II-GFP fusion protein was found to form a thick layer beneath the plasma membrane of cells exposed to hypertonicity for 10 min, whereas only a weak staining of the plasma membrane was observed in control cells (data not shown). Figure 1 | Hisactophilin is enriched in the cytoskeletal fraction of hyperosmotically shocked cells. Hisactophilin is enriched in the cytoskeletal fraction of hyperosmotically shocked cells. (A) Hisactophilin is enriched in the cytoskeletal fraction of cells hyperosmotically shocked for 2 h with respect to control cells suspended in SPB buffer for 2 h. (upper frames). Correspondingly, less hisactophilin was found in the cytosol of cells exposed to hypertonicity when compared to cells suspended in SPB buffer (lower frames). Proteins from cytosolic and cytoskeletal fractions were separated by 2-D electrophoresis. The frames show a silver-stained region of the gel corresponding to a molecular weight of 15 kDa and to an IEP of 7.3 --7.5. The predominant spot of each panel is indicated with an arrow. (B) Identification of the protein in (A) as hisactophilin by Western blotting of a typical gel of the cytoskeletal fraction and immunostaining of with a alpha-hisactophilin antibody. (C) The enrichment of hisactophilin in the cytoskeletal fraction of cells exposed to hypertonicity was confirmed by 1-D SDS-PAGE. The cytoskeletal fraction was isolated from cells suspended in SPB buffer (-) or in SPB buffer/400 mM sorbitol (+) for 2 h. The proteins were separated by SDS-PAGE and blotted. Immunostaining was performed with an alpha-hisactophilin antibody (right panel). The membrane was subsequently coomassie-stained (left panel). Abb.: M= marker. Hisactophilin is phosphorylated upon hyperosmotic stress | As phosphorylation is an important regulatory modification of actin and myosin II under hypertonic conditions, we investigated, whether this also applies for hisactophilin. Wild type cells deprived of phosphate were suspended in Mes buffer and were metabolically labeled with 32P-orthophosphate. After 1 h incubation, hyperosmotic shock was initiated and samples were withdrawn at intervals. Hisactophilin was isolated after cell lysis by immunoprecipitation. The samples were analyzed by autoradiography and subsequently by immunostaining with an alpha-hisactophilin antibody. Hisactophilin, that was isolated from cells shocked for 2 h, was found to be phosphorylated, whereas no detectable hisactophilin phosphorylation was observed in control samples isolated from cells suspended in SPB buffer for 1 h or 3 h . Analysis of the kinetics of the phosphorylation reaction revealed, that the phosphorylation does not constitute an acute stress response . Phospho-hisactophilin progressively accumulated 20 --60 min after onset of the shock condition. The result of the densitometric analysis revealed that the kinetics of phospho-hisactophilin can be fitted by a quadratic equation . Figure 2 | Hisactophilin is phosphorylated in wild type cells exposed to hyperosmotic conditions Hisactophilin is phosphorylated in wild type cells exposed to hyperosmotic conditions (A). Cells were metabolically labeled with 32P-orthophosphate prior to hypertonic shock. Hisactophilin was immunoprecipitated from samples withdrawn at T = 0 and T = 2 h. The probe was separated by SDS-PAGE and blotted. Autoradiography (left panels A,B) was performed for 48 h and hisactophilin was subsequently identified by immunostaining (right panels A, B). (+) denotes samples from shocked cells, (-) denotes samples from control cells suspended in SPB buffer. The arrow indicates the position of 15 kDa proteins. (B) The amount of phospho-hisactophilin progressively increased in hyperosmotically shocked cells. The experiment was performed as described in (A). (C) Densitometric analysis of the autoradiography in (B) reveals an exponential increase in phospho-hisactophilin upon hyperosmotic stress: the kinetics can be fitted by a quadratic function displayed in the figure. The densities are given in relative arbitrary units, setting the background as 0. To test the specificity of hisactophilin phosphorylation as a hyperosmotic stress response, wild type cells were labeled with 32P-orthophosphate and were then exposed to various other stress conditions. Subsequently, samples were withdrawn and hisactophilin phosphorylation was detected as described above. The phosphorylation reaction was found to be specific for hypertonic conditions, as other stress conditions as heat stress, acid stress, oxidative stress and energy depletion did not result in a detectable hisactophilin phosphorylation . Figure 3 | Hisactophilin phosphorylation is not a general stress response. Hisactophilin phosphorylation is not a general stress response. Autoradiographies are shown on the left panels, the corresponding immunostainings are displayed on the right panels. (A) Wild type cells were metabolically labeled with 32P-orthophosphate and were then exposed to various stress conditions. Hisactophilin phosphorylation was detected as described in Fig. . : Control (cells shaken in SPB buffer). 2: Cellular Acidification. 3: Heat stress. 4: Energy depletion. 5: Oxidative stress. 6: Hyperosmotic stress. (B) Hisactophilin phosphorylation is dependent on osmolarity, but not on the osmolyte. Wild type cells were metabolically labeled with 32P-orthophosphate and were then exposed to either 200 mM NaCl, 350 mM glucose or 400 mM sorbitol for 1 h. As control, cells were shaken in SPB buffer (1). Hisactophilin phosphorylation was detected as described in Fig. 2. To prove that the phosphorylation of hisactophilin is dependent on osmolarity, but not on the osmolyte used, wild type cells were exposed to hypertonic stress conditions, using either NaCl, glucose or sorbitol as osmolyte. The concentrations of the osmolytes were adjusted to 400 mOsm in the case of sorbitol (400 mM) and NaCl (200 mM) and a slightly reduced osmolarity (350 mOsm) was chosen in the case of glucose. Analysis of hisactophilin phosphorylation in response to the hypertonic stress conditions revealed that phosphorylation occurred to the same extent in the presence of all three osmolytes, indicating that hisactophilin phosphorylation is a hyperosmolar stress response . Serine phosphorylation of Hisactophilin | Recently, it has been demonstrated in vitro using a crude kinase fraction, that hisactophilin is phosphorylated on threonine (95%) and on serine residue(s) (5%) . We addressed the question, whether the phosphorylated residues are identical under hyperosmolar conditions in vivo. We therefore labeled wild type cells with 32P-orthophosphate, exposed them to hypertonic stress and immunoprecipitated hisactophilin. The protein probe was hydrolyzed in the presence of constant boiling HCl and was then separated together with phosphoamino acid standards by 2-D thin layer electrophoresis. 32P-labeled phosphoamino acids originating from phospho-hisactophilin were detected by autoradiography. Identification of the phosphoamino acid was performed by staining the standards with Ninhydrin and subsequent comparison of the staining pattern with the autoradiography. As shown in Fig. , only phospho-serine could be detected under in vivo conditions, whereas no phospho-threonine or phospho-tyrosine was observed, indicating that serine phosphorylation is favored over threonine phosphorylation under hyperosmotic stress conditions in vivo. Figure 4 | Hisactophilin is phosphorylated on serine residue(s) in vivo. Hisactophilin is phosphorylated on serine residue(s) in vivo. Wild type cells were metabolically labeled with 32P-orthophosphate and were then exposed to 400 mM sorbitol for 2 h. Hisactophilin was isolated by immunoprecipitation and was analyzed by 2-D thin layer electrophoresis. Phosphoamino acid standards were detected by Ninhydrin staining (positions indicated by lines) and were compared to the autoradiography. Abbreviation: part. hydrol.=partially hydrolyzed Hisactophilin-deficient cells exhibit reduced viability under hyperosmotic stress conditions | To investigate whether hisactophilin plays a role in osmoregulation, we determined whether survival of his--cells was affected under hypertonic conditions. The viability of his--cells was found to be reduced by 75% 2 h after onset of the stress condition, whereas viability of the wild type cells was not significantly affected . Hence, the presence of hisactophilin is essential to ensure viability under hypertonic conditions. Figure 5 | Viability of his--cells is reduced under hypertonic conditions. Viability of his--cells is reduced under hypertonic conditions. his--cells and wild type cells were suspended in either 400 mM sorbitol or SPB buffer for 2 h. Samples were plated together with bacteria and plaques were counted after 2 --4 days incubation (n = 5). Discussion : Dictyostelium was shown to employ an unusual mechanism to cope with the effects of osmotic stress by rearranging its cellular cortex . As the cells round up, actin and myosin moieties are being redistributed underneath the plasma membrane. In this process the distribution of the actin-associated protein Hisactophilin was investigated in order to gain a better insight into osmo-protective mechanism of the cell. Hisactophilin was found to be enriched in the cytoskeletal fraction of wild type cells exposed to hyperosmotic stress . In addition, a thick layer of Hisactophilin II-GFP was formed at the cell cortex of cells, that were shocked for 10 minutes (data not shown), which correlates with the observation that actin and myosin II are translocated to the cell cortex within 10 minutes after onset of the stress condition . As hisactophilin was shown to enhance actin polymerization in vitro and as cells overexpressing hisactophilin II exhibit an increased F-actin content , this protein could concur in the formation of the rigid filamentous network of actin and myosin II filaments. The essential role of hisactophilin becomes evident when hisactophilin negative cells are investigated under osmotic stress conditions. They show a markedly reduced survival rate in a test were they are first exposed to high osmolarity for 2 hours and are then plated onto agar plates containing bacteria. This procedure involves a volume reduction and a subsequent volume increase caused by the re-dilution in the plating process. It therefore remains to be investigated whether hisactophilin deploys its function in the process of rearranging the cell's cortex upon volume reduction or is essential for reinforcing the cortex in its rounded up state. A role comparably to the family of MARCKS (myristoylated alanine-rich protein kinase C substrate) proteins in mammalian cells was postulated recently . These proteins are also myristoylated at the N-terminus and crosslink actin into a rigid meshwork at the membrane. Upon phosphorylation, MARCKS proteins are rejected from the membrane by electrostatic interactions, which results in the spatial separation of the cytoskeleton from the membrane . In fact, hisactophilin phosphorylation was found to be specifically induced under hypertonic conditions (Fig. , ). However, the phosphorylation reaction is too slow to account for the translocation of the protein within 10 minutes : phospho-hisactophilin progressively accumulated within 60 min with a kinetics strikingly similar to the kinetics of actin phosphorylation under hyperosmotic conditions . This points out the possibility, that actin and hisactophilin cooperate in two distinct phases of osmoregulation. During the first phase, the proteins are translocated within the first 10 minutes of stress which is accompanied by cortical reinforcement. The second phase is characterized by actin and hisactophilin phosphorylation reinforced after about 30 min of hypertonic shock. Actin phosphorylation was shown to correlate with an inactivation of the dynamic actin system . The identical kinetics suggests a similar role for hisactophilin during this process. In addition, the coinciding phosphorylation kinetics raises the possibility of a common regulation of hisactophilin and actin phosphorylation. The signalling pathways regulating actin and hisactophilin phosphorylation are unknown, however, the second messengers involved in osmoregulation identified so far, namely cGMP and cAMP could be excluded as modulators of hisactophilin phosphorylation, as an increase or decrease in these messengers did not affect hisactophilin phosphorylation (data not shown). This suggests the presence of an additional signalling pathway concomitantly regulating a serine kinase specific for hisactophilin and, due to the identical phosphorylation kinetics, a tyrosine kinase specific for actin . A conceivable signalling pathway regulating the hisactophilin translocation is a change in pH, as the biochemical properties of Hisactophilin are strongly pH-dependent: actin-binding is strongly increased in vitro when pH is lowered to = 7.0 . In fact, progressive cytosolic acification was observed during hyperosmotic stress, resulting in a pH drop from 7.5 to 6.8 15 min after onset of the stress condition . Hence, the translocation of hisactophilin to the actin-rich cytoskeleton can be attributed to the cytosolic acidification. Also, the enrichment of the elongation factor 1alpha in the cytoskeletal fraction of hyperosmotically shocked cells can be explained by cytosolic acidification, as enhanced binding of this protein to F-actin at pH 6.5 in vitro has been described recently . These examples are in accordance with the notion of pH changes as "synergistic messenger" . Changes in proton concentration affect the biochemical properties of proteins and can thereby act as signals. However, other signals have to concur to elicit the osmoprotective responses: the translocation of hisactophilin potentially caused by the drop in cytosolic pH is complemented by the relocation of myosin II mediated by cGMP and of actin by a yet unknown mechanism. Therefore, the role of hisactophilin in osmoprotection also exemplifies the numerous interactions of the signalling pathways that are necessary for osmoprotection in Dictyostelium. Conclusions : We could demonstrate that Hisactophilin is both translocated to the cytoskeleton and phosphorylated during hyperosmotic stress in Dicytostelium. The phosphorylation kinetics suggests a slow accumulation of phosphorylated hisactophilin resembling the phosphorylation kinetics for actin, which is known to eventual lead to cytoskeletal inactivation. Second messengers known to play an essential role during osmoprotection are not involved in hisactophilin phosphorylation suggesting a further signalling pathway being involved in the unusual osmoprotection mechanisms in Dictyostelium. Materials and Methods : Growth of Dictyostelium cells | D. discoideum strain AX2-214 (AX-2), referred to as wild type, was cultivated axenically in shaken suspension at 21C and harvested during exponential growth. Clones of HsII-GFP were cultivated as described for AX-2, but under the selection of 20 mug/ml Geneticin (G418). Clones of his--cells were cultivated as described for AX-2, but under the selection of 7.5 mug/ml Geneticin. Hyperosmotic shock in liquid culture | Hyperosmotic shock experiments were performed according to Schuster et al. (1996). Axenically grown Dictyostelium cells were harvested, washed twice in Soerensen Phosphate Buffer (SPB: 2.0 mM Na2HPO4, 14.6 mM KH2PO4, pH 6.0) and were then adjusted to 2*107 cells/ml with SPB buffer (osmolarity: 34 mOsm). Cell density was 1,6*107 cells/ml during the osmoshock, adjusted by the addition of SPB buffer/2 M sorbitol. To the control cells, SPB buffer was added until the same cell density was reached. The cell suspension was shaken for 1 h. SPB buffer/2 M sorbitol was added to a final concentration of 400 mM sorbitol (osmolarity of the buffer: 434 mOsm). The cell suspension was incubated up to 2 hours according to the experiment. Viability of Dictyostelium cells after exposure of the cells to hyperosmotic stress was determined as described . In short, his--cells were shaken in SPB buffer for 1 h prior to the hyperosmotic shock. Samples were withdrawn at intervals and cell suspension corresponding to 200 cells was plated on agar plates together with Klebsiella aerogenes bacteria. Plaques in the bacterial lawn were counted after 2 --4 days. Exposure to stress conditions | To acidify Dictyostelium cells, axenically grown wild type cells were washed twice in SPB buffer and were resuspended in SPB buffer/5 mM propionic acid, pH 6.0. To impose oxidative stress, the cells were incubated in SPB buffer/3 mM H2O2 for 60 min. To study heat stress, the cells were exposed to 30C for 30 min. Energy depletion was achieved by incubating the cells in SPB buffer/50 muM 2,4-dinitrophenol for 60 min. 2-D Gel electrophoresis | Preparation of the cytoskeletal fraction from hyperosmotically shocked cells and separation of the proteins by 2-D gel electrophoresis was performed as described recently . The cytoskeletal fraction was obtained by isolating the Triton X-100-insoluble fraction. The corresponding soluble fraction was defined as cytosolic fraction. 100 mug total protein was applied per gel. Metabolic labeling with 32P-orthophosphate | 50 ml cell suspension of axenically grown wild type cells were transferred to 300 ml phosphate-free medium buffered with 20 mM Mes, pH 6.0. The cells were shaken for 16 h and were subsequently washed twice in ice-cold 20 mM Mes, pH 6.0 (Mes buffer). The cells were adjusted to 2*107 cells/ml with Mes buffer. After incubating the cells for 30 min, 32P-orthophosphate (Amersham Pharmacia) was added to a final activity of 0.25 mCi/ml in the cell suspension. The cell suspension was shaken for 60 min, before the cells were exposed to hyperosmotic shock. Samples of 1 ml were withdrawn at intervals, the cells were washed twice with Mes buffer and were resuspended in 800 mul RIPA buffer (50 mM Tris/HCl, pH 7.5; 150 mM NaCl, 1% TritonX-100; 1% Natriumdeoxycholate; 0.1% SDS; 1 mM DTT; 1 mM EDTA; 100 muM Na-orthovanadate; Complete Protease Inhibitor Cocktail (Boehringer Mannheim)). The cell lysate was immediately frozen in liquid nitrogen. As control, samples were prepared from a cell suspension to which Mes buffer was added instead of Mes buffer/2 M sorbitol. Immunoprecipitation of hisactophilin | Thawed cell lysate from 32P-labeled cells was centrifuged for 20 min at 10000 g (4C). alpha-hisactophilin antibody 54-11-10 was added to the cleared lysate and was incubated for 3 h. Immunoprecipitation was performed by adding fixed Staphylococcus aureus cells (Pansorbin, Calbiochem) preincubated with rabbit-alpha-mouse IgG (Sigma). After 45 min incubation, the immunoprecipitate was washed twice with TBS and was analyzed by SDS-PAGE, Western blotting and autoradiography. Fluorescence microscopy | Axenically grown HisII-GFP cells were shaken in SPB buffer for 1 h at a cell density of 2*107 cells/ml. SPB buffer/2 M sorbitol was added to a final concentration of 400 mM sorbitol (cell density: 1,6*106 cells/ml). An aliquot of the living cells was allowed to adhere to glass cover slips for 10 min. Subsequently, fluorescence microscopic observations were carried out. As control, cells suspended in SPB buffer were analyzed. The equipment consisted in a Leitz Aristoplan fluorescence microscope, set at 450 --490 nm for excitation. Phosphoamino acid analysis | Phosphoamino acid analysis was performed as described . In short, hisactophilin was immunoprecipitated from 32P-labeled cells exposed to hyperosmotic stress for 60 min. Acid hydrolysis of the immunoprecipitate was performed, followed by the separation of the phosphoamino acids by electrophoresis in two dimensions on TLC plates together with phosphoamino acid standards. The plates were analyzed by autoradiography and by the detection of amino acids with Ninhydrin. Miscellaneous | Protein quantification, SDS-PAGE and Western blotting onto PVDF membrane were performed according to the published methods of Bradford , Laemmli and Towbin et al.. Western blots were treated with the mouse monoclonal alpha-hisactophilin antibody 54-11-10 . Antibodies were detected using peroxidase-coupled rabbit-alpha-mouse IgG and the Renaissance system (Du Pont). Prestained Seeblue marker (Novex) was used as a protein molecular weight standard. Backmatter: PMID- 12057022 TI - Training practitioners in preparing systematic reviews: a cross-sectional survey of participants in the Australasian Cochrane Centre training program AB - Abstract | Background | Although systematic reviews of health care interventions are an invaluable tool for health care providers and researchers, many potential authors never publish reviews. This study attempts to determine why some people with interest in performing systematic reviews do not subsequently publish a review; and what steps could possibly increase review completion. Methods | Cross-sectional survey by email and facsimile of the 179 participants in Australasian Cochrane Centre training events between 1998 and 2000. Results | Ninety-two participants responded to the survey (51 percent). Response rate of deliverable surveys was 82 percent (92/112). The remainder of the participants had invalid or no contact information on file. More than 75 percent of respondents felt that the current workshops met their needs for training. The most critical barriers to completion of a Cochrane review were: lack of time (80 percent), lack of financial support (36 percent), methodological problems (23 percent) and problems with group dynamics (10 percent). Conclusions | Strategies to protect reviewer time and increase the efficiency of the review process may increase the numbers of trained reviewers completing a systematic review. Keywords: Background : Increasing emphasis is being placed on evidence-based medicine. The best evidence for treatment interventions comes from systematic reviews of randomised controlled trials, however, systematic reviews with meta-analysis of published and unpublished data are time- and labour-intensive. A major player in the evidence-based medicine movement has been the Cochrane Collaboration, an international organisation committed to 'preparing, maintaining and promoting the accessibility of systematic reviews of the effects of health care interventions.' The Australasian Cochrane Centre is one of the component centres of the Cochrane Collaboration, providing ongoing training and support to people in the Australasian region who prepare systematic reviews that are subsequently published on the Cochrane Library. The ultimate goal of the training program is to increase the number and quality of completed Cochrane reviews, and ensure that they are routinely updated. Currently, training occurs over two days, with the first day focusing on developing a protocol for a systematic review and the second, statistical analysis and interpretation of the review. Training sessions occur several times per year in locations throughout Australasia. In May 2001, the Australasian Cochrane Centre surveyed all of the participants of its training workshops during the years 1998 to 2000. We undertook this survey to: 1. determine why some people who attend Cochrane training workshop do not go on to publish a systematic review; and 2. what steps could increase systematic review completion. Methods : Survey Population and Contact Information | Our survey population included the 179 participants of the Australasian Cochrane Centre's training workshops from 1998 to 2000. Contact information for the year 2000 participants was drawn from the Australasian Cochrane Centre database (initiated in January 2000) of all workshop participants and current Cochrane reviewers in Australasia. Several partial data systems provided contact information for 1998 --1999 participants. Questionnaire | Participants were asked to respond to a cross-sectional survey of 21 'yes' or 'no' questions with a provision for open-ended comments. [See for the questionnaire used in this study.] The format of our internally developed questionnaire did not lend itself to statistical testing for internal consistency. No demographic details were collected, so that responses could be deidentified after receipt of the questionnaire. The initial questionnaire was sent via email or fax to all participants. A second email or fax was sent four weeks later, with a third survey sent via post to those participants who had not responded to the first two requests and had a postal address on file. Analysis | Both quantitative and qualitative methods were used in data analysis. The structured questions were analysed by SPSS for Windows software, release 10.0.5, and results were presented in the form of frequencies and percentages. Content analysis was used to analyse the qualitative responses. Publication status of workshop participants was determined by searching the Cochrane Library by each workshop participants' last name and first initial. Results : Response rate | Thirty-five questionnaires were returned as undeliverable (20 percent), with an additional 32 participants having no contact information on file with the Australasian Cochrane Centre (18 percent). [see Figure ] Of the 112 deliverable questionnaires (63 percent of participants), 54 participants (47 percent) responded after the first two mailings. With the third mailing, an additional 38 participants responded, creating an overall response rate for deliverable surveys of 82 percent. Eighteen people returned the survey without response, which provided us with 74 valid surveys (41 percent of participants) for analysis. Figure 1 | Survey Response of Workshop Participants Survey Response of Workshop Participants Publication status | Approximately 40 percent of these 1998 --2000 workshop participants have published a protocol or review on the Cochrane Library, as of 2001 issue 4. However, due to issues of anonymity of questionnaire response, we are unable to stratify the results based upon publication status. Findings from Questionnaire: Factors that Interfere with Systematic Review Completion | Lack of time emerged as the most critical barrier to completion of Cochrane reviews, with 80 percent of respondents citing this factor. Twenty respondents (36 percent) acknowledged lack of financial support, and twelve (21 percent), lack of institutional encouragement and support, as barriers to completion of their systematic review. Of the 31 people who offered qualitative comments, 11 suggested a need for dedicated time and support, with two needing better time management, and one wanting a grant to supply a research assistant. In a similar tone, seven people stated that other work or personal commitments take priority over Cochrane activities. [see Table ] Table 1 | Barriers for Training in, and Completion of, Systematic Review of the Literature Methodological barriers affected 23 percent of respondents. Three respondents specifically mentioned problems with translation of non-English papers, and two had no access to EMBASE (Excerpta Medica). In addition, one person was frustrated that a similar title for a Cochrane review had been registered, but not completed in a timely manner. Ten percent of respondents had problems with group dynamics, with two stating this factor as a significant delay to publication, and one complaining of contradictory editorial commentary. Thirteen respondents (22 percent) had yet to start a review. Nine respondents (16 percent) were working on a systematic review outside of the Cochrane Collaboration, with one qualitative commentator stating that the employer insisted on publication of the review prior to submission to Cochrane. A substantial minority (38 percent) of respondents felt that follow-up communication, especially via email, would help them complete their review. From the qualitative comments, this email could occur every one to six months, with 11 of the 12 respondents suggesting a time period of every three months or less. Findings from Questionnaire: Training Issues | Scheduling and content of the training workshops appeared to meet the needs of participants. Over 75 percent of respondents felt that the workshops were not too infrequent, too inconvenient, too far away, assumed too much knowledge, or were too long. Qualitative comments stressed the need for ongoing support after training. Three respondents requested a specific contact person, whereas another four asked for support to discuss general problems, statistical analysis issues, help selecting trials, and the creation of a bulletin board-style mentoring system. Three more respondents requested advanced training. In January 2000, the Australasian Cochrane Centre began collecting formal immediate evaluations from workshop participants. Analysis of these data indicates that the average participant self-ranks only slightly above an absolute beginner in systematic review methodology. Mean satisfaction with content, presentations, opportunity to ask questions, and overall satisfaction range between 4.5 to 4.7, on a scale from 1 = highly dissatisfied to 5 = highly satisfied. Finally, 83 percent of respondents stated that their Cochrane training had made them more likely to use the Cochrane Library to answer clinical questions. Only 45 percent, however, felt that their practice patterns had changed. Discussion : Lack of time is by far the most commonly reported barrier to completion of a systematic review. Financial, institutional, personal, and methodological issues are not problematic for the majority of respondents. These findings have important implications for both reviewers and entities commissioning systematic reviews. In the absence of funding for all or, at least, part of a systematic review, it will continue to be difficult for reviewers to do this research by taking more time out of their busy lives. The challenge becomes the ability to support researchers in minimising the time they spend on the process of the review, without affecting quality. Limitations in this study are several. First of all, the subjective nature of this study may have lead reviewers to state that lack of time was a barrier to completion of the project, when another reason, such as change in professional priorities was the 'true' barrier. Second, searching publications by last name and first initial may lead to either overstatement or understatement of publication status, as reviewers may have common last names, have changed their last names, or use a different first initial to the first name they use routinely. Finally, we had a large number of invalid addresses on file at the Australasian Cochrane Centre. The disruption of a move of the Australasian Cochrane Centre from Adelaide to Melbourne in 1999, with resultant staff turnover and loss of records, is responsible for much of our difficulty. However, we still had invalid contact information for almost one-quarter of the 2000 participants, whose training occurred less than 18 months prior to this survey. This lack of contact information is problematic as this survey suggests email communication could facilitate review completion. Strategies we plan to implement to improve the currency of our database include: 1. discussion at training events of the importance of informing the Australasian Cochrane Centre of change of address, 2. reminder notices on newsletters, and 3. liaison with other Cochrane entities. The year 2000 also saw a change in enrolment policy for the training workshops, allowing people to attend the course only if they had a title or protocol registered with the relevant Cochrane entity. Therefore, our results are likely to be more representative of recent participants of our program, committed to the Cochrane system. Conclusions : Lack of time, not skill, is the most common barrier to completion of a systematic review for authors who have attended such training given by the Australasian Cochrane Centre. One solution lies in advancements in methodology to make systematic reviews more efficient, such as automating aspects of the review or providing authors with specialised, centralised services in literature searches, project management, and the like. We expect that these advances in systematic review methodology, increased capacity for completing systematic reviews in Australasia, and realistic expectations regarding required investment of time for valid evidence will lead to an increased number and quality of systematic reviews published on the Cochrane Library. Ultimately, consumers and practitioners of health care around the globe should benefit from this increased knowledge. Competing interests : All authors were under the employ of the Australasian Cochrane Centre at the time of this survey. Authors' contributions : The authors contributed equally to the design and analysis of this project prior to Dr. Silagy's death in December 2001. Doctors Piehl and Green are responsible for all subsequent editorial changes. Pre-publication history : The pre-publication history for this paper can be accessed here: Backmatter: PMID- 12028592 TI - The regulation of protein synthesis and translation factors by CD3 and CD28 in human primary T lymphocytes AB - Abstract | Background | Activation of human resting T lymphocytes results in an immediate increase in protein synthesis. The increase in protein synthesis after 16 --24 h has been linked to the increased protein levels of translation initiation factors. However, the regulation of protein synthesis during the early onset of T cell activation has not been studied in great detail. We studied the regulation of protein synthesis after 1 h of activation using alphaCD3 antibody to stimulate the T cell receptor and alphaCD28 antibody to provide the co-stimulus. Results | Activation of the T cells with both antibodies led to a sustained increase in the rate of protein synthesis. The activities and/or phosphorylation states of several translation factors were studied during the first hour of stimulation with alphaCD3 and alphaCD28 to explore the mechanism underlying the activation of protein synthesis. The initial increase in protein synthesis was accompanied by activation of the guanine nucleotide exchange factor, eukaryotic initiation factor (eIF) 2B, and of p70 S6 kinase and by dephosphorylation of eukaryotic elongation factor (eEF) 2. Similar signal transduction pathways, as assessed using signal transduction inhibitors, are involved in the regulation of protein synthesis, eIF2B activity and p70 S6 kinase activity. A new finding was that the p38 MAPK alpha/beta pathway was involved in the regulation of overall protein synthesis in primary T cells. Unexpectedly, no changes were detected in the phosphorylation state of the cap-binding protein eIF4E and the eIF4E-binding protein 4E-BP1, or the formation of the cap-binding complex eIF4F. Conclusions | Both eIF2B and p70 S6 kinase play important roles in the regulation of protein synthesis during the early onset of T cell activation. Keywords: Background : The initiation of translation of mRNAs is an important control point in protein synthesis in eukaryotes and requires a set of initiation factors (eIFs). The cap-binding protein eIF4E recognises the 5'cap-structure of the mRNA, and is a component of the eIF4F complex consisting of eIF4E, eIF4G, a scaffolding protein , and eIF4A, an RNA helicase . Any secondary structure in the 5'untranslated region of the mRNA is thought to be unwound by eIF4A together with eIF4B or eIF4H . The 40S subunit of the ribosome binds to the eIF4F complex through an association between eIF4G and eIF3, which interacts directly with the 40S ribosomal subunit. The preinitiation complex, containing the 40S ribosomal subunit, eIF4F, eIF4B, and Met-tRNAi*eIF2*GTP, scans the 5'UTR until the AUG start codon is located. The subsequent hydrolysis of the GTP bound to eIF2 is promoted by eIF5, after which eIF2*GDP leaves the ribosome. The 60S ribosomal subunit can then join and the 80S complex is formed. eIF2 in the GDP-bound state is inactive and, in order to return to the active form again, the GDP is exchanged for GTP in a step promoted by the guanine nucleotide exchange factor eIF2B. The next stage in the translation process, the elongation step, can be regulated via changes in the activity of eEF2 . Phosphorylation of eEF2 at Thr56 results in its complete inactivation . Human primary T-cells are metabolically quiescent, with little ongoing DNA, RNA or protein synthesis . The low protein synthesis rate in quiescent T cells is associated with low levels of initiation factors in these cells. The rate of protein synthesis increase 2 --4 fold after 4 h of mitogenic stimulation , and it has been reported that the mRNA and protein levels for several translation initiation factors increased during T cell activation. The mRNA levels of eIF4A, eIF2alpha, and eIF4E increased rapidly after stimulation . However, the increase in the levels of the corresponding protein lagged significantly behind. It is therefore likely that increased levels of translation factors contribute to the pronounced stimulation of protein synthesis that occurs during T cell activation at later times, while modulation of the activity of several translation initiation factors e.g. by phosphorylation or association with binding proteins is important in the early phase of T cell activation . Increased phosphorylation of eIF4E in T lymphocytes has been reported under several conditions. Activation of quiescent mature porcine peripheral blood mononuclear cells with phorbol 12-myristate 13-acetate (PMA) or concanavalin A or stimulation of human primary T cells with PHA , PMA, or PMA plus ionomycin caused a rapid increase in the phosphorylation of eIF4E. Similarly, stimulation of the T cell receptor in the human leukaemic T cell line Jurkat with OKT-3, or treatment with PMA, increased eIF4E phosphorylation , and a significant increase in the amount of eIF4F complexes was also detected. The activity of eIF4E can also be modulated by its association with eIF4E-binding proteins, of which 4E-BP1 is the best-studied. Phosphorylation of 4E-BP1 leads to its dissociation from eIF4E, leaving eIF4E free to bind eIF4G and form eIF4F complexes . In a murine cytotoxic T cell line, interleukin-2 induced the phosphorylation of 4E-BP1 . 4E-BP1 is present in human primary T lymphocytes and becomes phosphorylated in response to PMA or PMA plus ionomycin . In several cell lines, an increase in eIF2B activity coincides with an increase in protein synthesis . One mechanism to regulate the activity of eIF2B is via phosphorylation of its epsilon-subunit (eIF2Bepsilon) by GSK-3, which causes a decrease in eIF2B activity . Stimulation of T cells with PMA plus ionomycin caused a rapid rise in eIF2B activity, which coincided with inactivation of GSK-3 , suggesting a role for dephosphorylation of eIF2Bepsilon. The activity of eIF2B can also be modulated by phosphorylation of the alpha-subunit of eIF2. eIF2 phosphorylated in its alpha-subunit acts as a competitive inhibitor of eIF2B . Stimulation of T cells with PHA did not cause significant changes in the phosphorylation state of eIF2alpha , excluding this mechanism of regulation under this condition. In this study we used the antibodies, alphaCD3 and alphaCD28, to activate resting human primary T lymphocytes. Engagement of alphaCD3 activates the T cell receptor, while cross-linking of alphaCD28 with the B7 receptor will supply a co-stimulatory signal, which is required for full activation of a resting T cell . We have studied the effects of T cell activation on protein synthesis and on the activities and/or phosphorylation states of several translation initiation factors. Furthermore, the signalling pathways involved in these changes have been investigated. Results : Activation of primary T cells with a physiological stimulus increased protein synthesis | We activated T cells with the antibodies, alphaCD3 and alphaCD28, for up to 24h and measured protein synthesis and the activation of several signalling pathways that are important for the regulation of translation factors and that have been shown to increase after activation of T cells . Figure 1 | Activation of T cells with alphaCD3 and alphaCD28. Activation of T cells with alphaCD3 and alphaCD28.A. Primary T lymphocytes were activated with both alphaCD3 and alphaCD28 for 4, 8, 16 or 24 h and for the last 45 min 10 muCi/ml of [35S]-labelled methionine was present. The experiment was performed in duplicate. Incorporation of [35S]-labelled methionine into equal amounts of protein was measured. Protein synthesis in control cells was set at 100%. Methionine incorporation ranged between 1000 and 2000 cpm per 50 mug of protein. (control cells at t = 0 h and t = 24 h are not significantly different, n = 3). B. T cells were activated by alphaCD3 and alphaCD28 or with PMA. Cells were activated for 30 min, harvested and 50 --80 mug of lysate was analyzed by SDS-PAGE and Western blotting. Antibodies that recognize the phosphorylated form of either ERK (pp42) or p38 MAPK (pp38) were used. Even loading of the gel was verified using anti-ERK2 (p42). Similar results were obtained in three sets of experiments. C. PKB activity was measured as described in Materials and Methods (p<0.05, n=4). The rate of protein synthesis in resting T cells is low, and activation of the cells with alphaCD3 and alphaCD28 led to a substantial increase in the incorporation of [35S]-methionine into protein. Within 24 h of activation, the rate of protein synthesis was increased 6-fold , depending on the blood donor. After 30 min of activation, phosphorylation of ERK and p38 MAPK, and the activity of PKB were measured. Phosphorylation of ERK2 and p38 MAPK increased already after 5 min and reached a maximum after 30 --60 min of treatment (data not shown). After 30 min of treatment, a clear phosphorylation of ERK and p38MAPK was detected . Treatment with PMA, a potent activator of PKC, was used as a positive control. PMA induced, in particular, a greater extent of phosphorylation of ERK than alphaCD3 plus alphaCD28. For p38 MAPK phosphorylation, the difference between these stimuli was less pronounced . An 1.5 fold increase in PKB activity was detected within 30 min of activation of T cells by alphaCD3 and alphaCD28. The increase in protein synthesis and the stimulation of various signalling pathways indicated that treatment of T cells with alphaCD3 and alphaCD28 led to activation of the cells. The cellular protein levels of eIF4E and eIF2Bepsilon do not change during the early phase of T cell activation | Previous studies using mitogenic stimuli showed that the levels of several initiation factor proteins increase later (>16 h) following T cell activation and probably contribute to the increase in protein synthesis . To examine whether activation of T cells with alphaCD3 and alphaCD28 also affected initiation factor levels, the amounts of the cap-binding protein, eIF4E, and of the catalytic subunit of the eIF2B complex, eIF2Bepsilon, were assessed at different time points . The amounts of eIF4E and eIF2Bepsilon protein each remained constant during the first 6 h. Figure 2 | The amount of eIF4E and eIF2Bepsilon protein did not change in the early phase of T cell activation. The amount of eIF4E and eIF2Bepsilon protein did not change in the early phase of T cell activation. T cells were activated with alphaCD3 and alphaCD28 for the indicated times. In each case, 600 mug of protein was used for an m7GTP Sepharose pull down to detect the amount of eIF4E or used in an immunoprecipitation reaction with alphaeIF2Bepsilon coupled to protein G to detect eIF2Bepsilon. The pull downs were analyzed by SDS-PAGE and Western blotting. The experiment was performed in duplicate. In this study, we have focused on the mechanisms underlying the initial response after activation of primary T cells by alphaCD3 and alphaCD28 and the concomitant increase in protein synthesis. Since the levels of initiation factor proteins did not change in this early phase of T cell activation, we considered the possibility that changes in the phosphorylation state and/or activities of several translation factors were involved in the initial activation of protein synthesis in T cells. Protein synthesis is regulated via multiple signalling pathways | Primary T lymphocytes were activated with alphaCD3 and alphaCD28, and after 1 h of activation, protein synthesis was increased 1.2 fold . To study the signalling events involved in this increase in protein synthesis, we performed the experiment in the presence of different specific signal transduction pathway inhibitors . The increase in overall protein synthesis was consistently blocked by each of the signal transduction inhibitors used, i.e. the PI 3-kinase inhibitor wortmannin, the mTOR inhibitor rapamycin, the p38 MAPKalpha/beta inhibitors SB203580 and SB202190, and the MEK inhibitor PD98059. It appears that the immediate activation of protein synthesis in T cells involves interplay between several signalling pathways. Figure 3 | The increase in protein synthesis requires signalling via several pathways. The increase in protein synthesis requires signalling via several pathways. T cells were preincubated with wortmannin (W, 100 nM), rapamycin (R, 100 nM), SB203580 (10 muM), SB202190 (10 muM) or PD98059 (PD, 50 muM) for 30 min before activation with both alphaCD3 and alphaCD28 for 1 h or the cells were treated with PMA (1 muM) for 1 h. For the last 30 min of activation 10 muCi/ml [35S]-labelled methionine was present. The experiment was performed in duplicate. Protein synthesis in control cells was set at 100%. Methionine incorporation ranged between 600 and 1500 cpm per 50 mug of protein. Incorporation of [35S]-labelled methionine into equal amounts of protein was measured using hot TCA precipitation (p<0.05 for the alphaCD3/28 and PMA treated samples; all other samples are not significantly different from the control, n=6). Stimulation of T cells with the more potent stimulus PMA for 1 h led to a substantially larger increase in protein synthesis (1.8 fold) compared to activation with alphaCD3 and alphaCD28 . Phosphorylation of eIF4E, eIF4F complex formation and 4E-BP1 phosphorylation remain unchanged after T cell activation | Phosphorylation of the cap-binding protein eIF4E can be regulated via the ERK and p38 MAPKalpha/betapathways , two pathways that appear to be important for the regulation of protein synthesis in T cells . Furthermore, the phosphorylation of eIF4E has been reported to be increased in response to several different treatments of primary T lymphocytes or the Jurkat T cell line . However, activation of T cells with alphaCD3 and alphaCD28 for up to 60 min did not cause a significant change in the phosphorylation state of eIF4E . Stimulation of T cells with either alphaCD3 or alphaCD28 alone was also insufficient to change the phosphorylation state of eIF4E (data not shown). We did detect a marked change in phosphorylation of eIF4E after 30 min of PMA treatment, indicating that the cells respond to this stimulus . In addition, treatment of the Jurkat T cell line with alphaCD3 and alphaCD28 caused phosphorylation of eIF4E that was already detectable after 30 min, demonstrating the effectiveness of the antibodies (alphaCD3 and alphaCD28) used . Figure 4 | Regulation of eIF4E phosphorylation and eIF4F formation. Regulation of eIF4E phosphorylation and eIF4F formation.A. Jurkat T cells were activated for 30 or 60 min by both alphaCD3 and alphaCD28. The primary T lymphocytes were activated for the indicated times with both alphaCD3 and alphaCD28 or with PMA. eIF4E was purified using m7GTP Sepharose, analyzed on a one-dimensional iso-electric focusing gel and detected by Western blotting. 4E and 4E-P indicate unphosphorylated and phosphorylated eIF4E respectively. B. 100 mug of total cell lysate from primary T cells treated for 1 h with alphaCD3 and alphaCD28 or PMA was analyzed by SDS-PAGE and Western blotting to detect 4E-BP1. (-) indicates untreated cells. The lane with 4E-BP1 from HeLa cell extract was obtained from a shorter exposure from the same blot. C. Formation of eIF4F was analyzed after 60 min activation of primary T cells with either alphaCD3, alphaCD28 or both. eIF4E was purified as described above and its association with eIF4G was analyzed by SDS-PAGE and Western blotting. An eIF4E blot was used to verify equal loading of all lanes. Similar results for eIF4E, eIF4G and 4E-BP1 were obtained in three independent experiments. An important way of regulating eIF4F assembly is through eIF4E-binding proteins such as 4E-BP1. Phosphorylation of 4E-BP1 leads to its release from eIF4E, allowing the latter protein to bind eIF4G . The phosphorylation of 4E-BP1 can be detected by virtue of a reduction in its mobility upon SDS-PAGE . As a control to demonstrate that different forms of human 4E-BP1 can be resolved on our gel system, we used HeLa cell extract and in this case three separate bands (alpha, beta and gamma) were indeed detected , indicative of differently phosphorylated forms. In resting T-cells, 4E-BP1 was mainly present in the unphosphorylated form (alpha-form) as reported before . We were unable to detect any changes in mobility of 4E-BP1, and therefore its phosphorylation after stimulation of the cells with alphaCD3 plus alphaCD28 or PMA . Formation of eIF4F complexes was studied by purification of eIF4E on m7GTP-Sepharose followed by a Western blot to detect associated eIF4G. In resting T cells, eIF4F complexes are already present, and after 1h of activation with alphaCD3, alphaCD28, or both antibodies, the amount of eIF4G bound to eIF4E remained unchanged . Similar results were obtained after 30 min of activation (data not shown). Surprisingly, no 4E-BP1 associated with eIF4E was detected, even though up to 2 mg of T cell extract was used in a m7GTP Sepharose pull down (data not shown). This could be due to low amounts of 4E-BP1 protein present in resting T cells. These data indicate that increased formation of eIF4F complexes is not required for the activation of protein synthesis in the early phase of T cell activation. Regulation of eIF2B activity after activation of T cells | In several cell types, an increase in overall protein synthesis coincides with an increase in eIF2B activity . We therefore examined the activity of eIF2B after activation of primary T cells . After 1 h of activation with alphaCD3 and alphaCD28, the activity of eIF2B increased 2.2 fold. The increase in eIF2B activity was not caused by a change in the phosphorylation state of the alpha-subunit of eIF2 or by an increase in the amount of eIF2Bepsilon protein (Figs. and and ). Immunoprecipitation of different amounts of T cell extracts showed that the eIF2Bepsilon antibody was able to detect different levels of protein in the immunoprecipitations within the same range used in Fig. (bottom panel). Taken these results together it suggested that eIF2B was regulated directly, e.g. via phosphorylation. To study which signal transduction pathways are involved in the regulation of the activity of eIF2B, the cells were activated in the presence of specific signal transduction pathway inhibitors and eIF2B activity was measured. The basal activity of eIF2B was slightly affected in the presence of the PI 3-kinase inhibitor wortmannin, the mTOR inhibitor rapamycin, and the p38 MAPKalpha/beta inhibitor SB203580, however the alphaCD3 plus alphaCD28-induced increase in eIF2B activity was completely blocked in the presence of each inhibitor. The MEK inhibitor PD98059 did not affect the basal eIF2B activity and was also able to inhibit the alphaCD3 and alphaCD28-induced increase in eIF2B activity, showing that all these signalling pathways are required to mediate the activation of eIF2B . Figure 5 | Regulation of eIF2B activity. Regulation of eIF2B activity.A. T cells were preincubated with wortmannin (W, 100 nM), rapamycin (R, 100 nM), SB203580 (SB, 10 muM), or PD98059 (PD, 50muM) for 30 min and left untreated (white bar) or the cells were activated with both alphaCD3 and alphaCD28 (black bar) for 1 h. Simultaneously cells were activated with PMA (hatched bar) for 1 h. An eIF2B assay was performed as described in Materials and Methods. Bars marked with * are significantly different from the untreated cells (p<0.05, n=5). B. Cell lysates from resting and stimulated cells (1 h alphaCD3 and alphaCD28) were analyzed by SDS-PAGE and Western blotting to detect phosphorylated eIF2alpha. eIF2B was immunoprecipitated from 400 mug of lysate using alphaeIF2Bepsilon and the amount of protein was analyzed by SDS-PAGE and Western blotting. Similar results were obtained in three experiments C. To test the sensitivity of the eIF2Bepsilon antibody different amounts of T cell extracts (as indicated) were immunoprecipitated with alphaeIF2Bepsilon and analyzed by SDS-PAGE and Western blotting. Similar results were obtained in two experiments. D. T cells were left untreated (white bar) or the cells were activated with both alphaCD3 and alphaCD28 (black bar) or PMA (grey bar) for 1 h. GSK-3alpha and beta were immunoprecipitated together from 400 mug of lysate and a kinase assay was performed as described in Materials and Methods (p<0.05, n=4). E. eIF2Bepsilon was immunoprecipitated from 400 mug of lysate from resting and stimulated cells (1 h alphaCD3 and alphaCD28) and the total amount of eIF2Bepsilon and the phosphorylation state of Ser540 were analyzed by SDS-PAGE and Western blotting. Similar results were obtained in two experiments. Activation of eIF2B after stimulation of the cells with PMA was about 2 fold higher than after stimulation with the antibodies. An increase in eIF2B activity after stimulation of primary T-cells with PMA/ionomycin has been reported before . It has been suggested that GSK-3 may be an important regulator of eIF2B activity, i.e. in response to insulin and during cell survival . Phosphorylation of eIF2Bepsilon by GSK-3 inhibits the activity of the eIF2B complex . GSK-3 activity is decreased only by a small extent (15%) after T cell activation with alphaCD3 and alphaCD28 . In contrast, PMA treatment reduced GSK-3 activity by about 50%, which is similar to previously reported data. GSK-3 phosphorylates eIF2Bepsilon on Ser540. Therefore, we analyzed the phosphorylation state of this site using a phospho-specific antibody. We were unable to detect any change in the phosphorylation of this site in response to alphaCD3 and alphaCD28, excluding a role for GSK-3 in the regulation of eIF2B activity in T cells under these conditions. Dephosphorylation of eEF2 | Elongation factor 2 (eEF2) plays an important role in the regulation of the rate of elongation, and therefore in the regulation of the rate of overall protein synthesis. Phosphorylation of eEF2 causes its inactivation . Phosphorylation of eEF2 was rapidly but only transiently decreased after activation of the primary T lymphocytes with alphaCD3 and alphaCD28 . Within 3 min, maximum dephosphorylation was reached and the phosphorylation level returned to a level similar to that of resting T cells by 10 min. Given the transient nature of these changes, it is unlikely that regulation of eEF2 plays a role in the sustained increase in the rate of protein synthesis after activation of T cells. However, dephosphorylation of eEF2 could play a role very early in T cell activation. Figure 6 | Dephosphorylation of eEF2 after T cell activation. Dephosphorylation of eEF2 after T cell activation. T cells were activated with alphaCD3 and alphaCD28 for the indicated times. 80 mug of protein was analyzed by SDS-PAGE and Western blotting. Phosphorylation of eEF2 was detected using a phospho-specific antibody (eEF2-P). ERK2 was detected as a loading control. Similar results were obtained in three experiments. Regulation of p70 S6 kinase upon T cell activation | Activation of p70 S6 kinase and phosphorylation of the ribosomal protein S6, an in vivo substrate of p70 S6 kinase, coincide with increased translation of specific mRNAs, namely the 5'TOP mRNAs . However, a recent report has questioned the role of p70 S6 kinase in 5'TOP messenger translation . We studied the effect of activation of T cells with alphaCD3 plus alphaCD28 on these proteins. The activity of p70 S6 kinase was increased about 1.5 fold after 60 min, and the increase in p70 S6 kinase activity was blocked by each of the signal transduction inhibitors used, i.e. wortmannin, PD98059, SB203580, and rapamycin . Similar results were obtained when the phosphorylation of the S6 protein was examined as a cellular read-out of p70 S6 kinase activity . Phosphorylation of S6 in response to PMA was greater than in response to alphaCD3 and alphaCD28, similarly to the situation for several translation factors, as described above. Figure 7 | Regulation of p70 S6 kinase. Regulation of p70 S6 kinase.A. Primary T lymphocytes were preincubated with wortmannin (W, 100 nM), rapamycin (R, 100 nM), SB203580 (SB, 10 muM), or PD98059 (PD, 50 muM) for 30 min before activation with both alphaCD3 and alphaCD28 (black bars) for 60 min. Bars marked with * are significantly different (p<0.01) from the activity in untreated cells (n=4). B. T cells were preincubated with wortmannin (W, 100 nM), rapamycin (R, 100 nM), SB203580 (SB, 10 muM), or PD98059 (PD, 50 muM) for 30 min before activation with both alphaCD3 and alphaCD28 for 60 min or the cells were stimulated with PMA for 60 min. Phosphorylation of the S6 protein was analyzed by SDS-PAGE and Western blotting using a phospho-specific S6 (Ser235) antibody. Similar results were obtained in four experiments. Discussion : The mechanisms underlying the regulation of protein synthesis following activation of resting primary T cells has not been widely studied. Early reports showed that stimulation of primary T cells with pharmacological stimuli, e.g. PHA or PMA, led to an increase in protein synthesis and protein levels of certain translation initiation factors within 16 h . More recently the regulation of protein synthesis and translation factors after a 6 h stimulation of primary T cells with PMA or PMA/ionomycin was described in detail . We investigated the regulation of protein synthesis and translation factors during the early phase of activation of resting T cells by alphaCD3 and alphaCD28, i.e. 1 h of activation. The protein synthesis rate in T cells rapidly increased after treatment , and several signalling pathways, i.e. ERK and p38 MAPK phosphorylation and PKB activation, were stimulated, showing the efficacy of the alphaCD3 and alphaCD28 antibodies in activating the cells. The increase in protein synthesis after 1 h was mediated via multiple signalling pathways, e.g. the MEK, p38 MAPKalpha/beta, PI 3-kinase and mTOR pathway, as indicated by the use of signal transduction inhibitors . In several cell types, the involvement of either MEK , PI 3-kinase or mTOR [,,-] in the activation of protein synthesis has been described. However, this is the first time that a role for the p38 MAPKalpha/betapathway in the regulation of overall protein synthesis has been described. This role is supported by the fact that two structurally unrelated p38 MAPKalpha/beta inhibitors, i.e., SB202190 and SB203580, were each able to block the increase in protein synthesis. The increase in protein synthesis after activation of T cells with alphaCD3 and alphaCD28 coincided with an increase in the activities of p70 S6 kinase and eIF2B and dephosphorylation of eEF2, which is indicative of an increase in its activity . The dephosphorylation of eEF2 was very transient, and therefore it is unlikely that eEF2 plays an important role in the sustained increase in protein synthesis after T cell activation. However, activation of eEF2 could be important for the initial increase in protein synthesis. The stimulation of p70 S6 kinase was mediated via similar signalling pathways (Fig. 7) to those underlying the activation of overall protein synthesis. Inhibition of PI 3-kinase, mTOR, p38 MAPKalpha/beta, or MEK during T cell activation by alphaCD3 and alphaCD28 prevented the activation of p70 S6 kinase, indicating that multiple signalling pathways are required for regulation of p70 S6 kinase activity. The effect of rapamycin on the activation of p70 S6 kinase in response to alphaCD3 and alphaCD28 has been reported previously . Inhibition of the activation of p70 S6 kinase by SB203580 has been described before in insulin-stimulated rat vascular smooth muscle cells [,-]. Furthermore, it has been reported that SB203580 (at the concentration used, 10 muM) can inhibit phosphorylation of PKB at Threonine308 and thus its activation . Since PKB is an upstream component of the signalling pathway towards p70 S6 kinase, this could provide a mechanism by which SB203580 blocks activation of p70 S6 kinase. Each of the other signalling pathways studied here has also been implicated in the regulation of p70 S6 kinase activity in a variety of cell types under a range of conditions [,-]. However, in human primary T cells all of them appear to be important for the regulation of p70 S6 kinase activity after stimulation with alphaCD3 and alphaCD28. The activity of the guanine nucleotide exchange factor, eIF2B, also was mediated via similar signalling pathways as the increase in protein synthesis . The increase in eIF2B activity after activation of T cells with alphaCD3 and alphaCD28, at the early times we examined, was not due to an increase in eIF2B protein level or to changes in eIF2alpha phosphorylation. Therefore, modification of the eIF2B protein complex probably caused the increase in eIF2B activity. The modulation of the activity of the eIF2B complex after activation of T cells with alphaCD3 and alphaCD28 required several different signalling pathways, e.g. MEK, p38 MAPKalpha/beta, mTOR and the PI 3-kinase pathway. These signalling pathways have been reported separately to be involved in the regulation of eIF2B activity . However, this is the first report where all these pathways are involved in the regulation of eIF2B in a single cell type. A small inactivation of GSK-3 was detected after activation of primary T cells with alphaCD3 and alphaCD28. However, no dephosphorylation of Ser540 in eIF2Bepsilon was detected , excluding a role for GSK-3 in regulating the activity of eIF2B under these conditions. In contrast, studies employing PMA/ionomycin-activated T cells , insulin treatment of various cell types , and cell survival have implied a role for GSK-3 in regulating eIF2B activity. In contrast to previously reported data using mitogenic stimuli to activate primary T cells or Jurkat T cells , eIF4E phosphorylation, association of eIF4G with eIF4E and 4E-BP1 phosphorylation remained unchanged after T cell activation using alphaCD3 and alphaCD28 as a stimulus . Signal transduction inhibitor studies showed that the MEK and p38 MAPKalpha/beta pathways are important for eIF4E phosphorylation in Jurkat T cells , and a role for MEK was demonstrated previously in primary T cells . The weaker activation of the ERK pathway in particular by alphaCD3 and alphaCD28 in primary T cells may well account for the absence of increased phosphorylation of eIF4E under these conditions. We did not observe increased phosphorylation of 4E-BP1 in response to alphaCD3 and alphaCD28, even though it has been reported to occur after cytokine stimulation of a murine cytotoxic T cell line or after 6 h of mitogenic stimulation of human primary T cells . However, Grolleau et al. showed that 4E-BP1 was present in primary T cells mainly in its dephosphorylated form, and no significant change was detected after PMA treatment. Our results are consistent with this last finding; 4E-BP1 is mainly present as one band, and no change in mobility is observed upon cell treatment. This is consistent with the observation that eIF4F complex formation did not alter. However, it remains surprising that eIF4F complexes are present when 4E-BP1 is completely dephosphorylated, and therefore presumably associated with eIF4E. We were unable to detect any 4E-BP1 associated with eIF4E, which is probably due to the low 4E-BP1 protein levels in resting T lymphocytes, thus explaining basal eIF4F formation. Conclusions : The treatment of primary T lymphocytes with alphaCD3 and alphaCD28 activates two key components of the translational machinery, p70 S6 kinase and eIF2B. The activities of these translation factors were regulated similarly to the activation of protein synthesis, consistent with an important role for the components in the activation of protein synthesis by alphaCD3 and alphaCD28. Interestingly, activation of protein synthesis, p70 S6 kinase, and eIF2B is inhibited by rapamycin, a compound that was first discovered as an immunosuppressant, suggesting that mTOR regulated translation is involved in the process of T cell proliferation. The activation of p70 S6 kinase is related to the regulation of translation of specific mRNAs, while the activation of eIF2B is likely to be required for stimulation of general protein synthesis . This suggests that increases in both specific and general protein synthesis are important in the early phase of T cell activation. Materials and methods : Primary T cell isolation and cell treatment | Buffy coats used for the isolation of T cells were prepared from freshly drawn blood from healthy human donors and were obtained from the Scottish National Blood Transfusion Service (Edinburgh, UK). Mononuclear leukocytes were isolated by Ficoll-Hypaque (Amersham-Pharmacia) gradient centrifugation. T cells were further enriched using nylon-wool columns. T cells were suspended in RPMI 1640 medium supplemented with 10% (v/v) heat-inactivated foetal calf serum, 1 mM glutamine and antibiotics/antimycotics (100 units/ml penicillin G sodium, 100 mug/ml streptomycin sulphate and 0.25 mug/ml amphotericin B). The cells were kept in 75 cm2 tissue culture flasks at a density of 4 x 106 cells/ml at 37C and 5% CO2. All tissue culture reagents were obtained from Gibco BRL. Measurement of protein synthesis rate | Cells were treated with alphaCD3 mouse IgG2a mAb (33/2A3) (1:1000 dilution from a hybridoma supernatant) and alphaCD28 mouse IgM mAb (CK243) (1:12 dilution from a hybridoma supernatant) for 1 h in the absence or presence of signal transduction inhibitors. For the last 30 min, 10 muCi/ml [35S]methionine was added to the cells. To harvest the cells, the cells were transferred to a microfuge tube and centrifuged at 6000 x g for 20 s. The cell pellet was lysed in 20 mM Hepes pH7.4, 50 mM beta-glycerophosphate, 0.2 mM EDTA, 1% Triton X-100, 10% (v/v) glycerol, 1 mug/ml leupeptin, 1 mug/ml pepstatin, 1 mug/ml antipain, 1 mM benzamidine, and 1 mM DTT. Part of the sample was used to measure the protein content with Protein Assay Reagent (Bio-Rad) and the rest was spotted in duplicate on to Whatman 3 MM paper and subjected to 'hot TCA precipitation'. Gel electrophoresis and Western blotting | T cells were activated with alphaCD3 and alphaCD28 for times indicated in the figure legends, harvested in Laemmli sample buffer and analyzed by SDS-PAGE and Western blotting. Phospho-p42/44(ERK) and phospho-p38 MAPK antibodies were obtained from New England Biolabs, the phospho-eIF2alphaantibody was a kind gift from Dr. Gary Krause (Detroit, USA), the phospho-S6 (Ser235) antibody was a kind gift from Dr. Dario Alessi (University of Dundee), the 4E-BP1 antibody was obtained from Santa Cruz (SC-6025), the eIF2Bepsilon antibody was raised in rabbit against the whole protein expressed in the baculovirus system , the phospho-specific antibody for Ser540 in eIF2Bepsilon was raised against the peptide SEEPDS(P)RGGC (S(P) indicates the phosphoserine) in sheep, and the phospho-eEF2 (Thr56) antibody was raised against the peptide GETRFT(P)DTRK (T(P) indicates phosphothreonine) . Kinase assays | For PKB assays, the cells were pelleted at 6000 xg for 20 s and harvested in 50 mM Tris-HCl pH 7.5, 1 mM sodium orthovanadate, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, 50 mM NaF, 5 mM sodium pyrophosphate, 0.27 M sucrose, 1 muM microcystin LR, 1 mug/ml leupeptin, 1 mug/ml pepstatin, 1 mug/ml antipain, and 1 mM benzamidine-HCl. Antibodies directed against the three PKB isoforms (alpha, beta, and gamma) were simultaneously bound to protein G-Sepharose, and about 100 mug of protein was used in immunoprecipitation reactions. The immunoprecipitation and PKB assays were performed as described before . For p70 S6 kinase and GSK-3 assays, the cells were harvested in a buffer containing 50 mM Tris-HCl pH 7.5, 50 mM beta-glycerophosphate, 0.5 mM sodium vanadate, 1.5 mM EDTA, 1.5 mM EGTA, 0.5% Triton X-100, 1 mug/ml leupeptin, 1 mug/ml pepstatin, 1 mug/ml antipain, 1 mM benzamidine, and 1 mM DTT. A polyclonal antibody raised against a peptide sequence from p70 S6 kinase-1 was bound to protein G-Sepharose, and about 100 mug of extract was used in the immunoprecipitation reaction. Immunoprecipitation and the p70 S6 kinase assays (using a peptide substrate) were performed as described before . GSK-3alpha and beta were immunoprecipitated together from 150 mug of cell lysate and kinase assays were performed as described . Phosphorylation of eIF4E and eIF4F complex formation | Cells were pelleted at 6000 x g for 20 s and harvested in a buffer containing 20 mM Hepes pH7.4, 50 mM beta-glycerophosphate, 0.2 mM EDTA, 1% Triton X-100, 10% (v/v) glycerol, 1 mug/ml leupeptin, 1 mug/ml pepstatin, 1 mug/ml antipain, 1 mM benzamidine, and 1 mM DTT. Using m7 GTP Sepharose 4B (Amersham-Pharmacia; 15 mul of slurry diluted with 15 mul of Sepharose CL-4B), eIF4E was purified from approximately 2 mg of extract. For SDS-PAGE, Laemmli sample buffer was added and the samples were heated at 95C for 10 min. For one-dimensional iso-electric focusing analysis, the appropriate sample buffer was added . The samples were run on a 12.5% SDS-PA gel or on a one-dimensional iso-electric focusing gel, transferred to PVDF, and detected by Western analysis. eIF4E was detected with a polyclonal antibody raised in rabbit , and eIF4GI with a polyclonal antibody raised in sheep against the peptide CKKEAVGDLLDAFKEAN. Measurement of eIF2B activity | The cells were pelleted at 6000 x g for 20 s and lysed in a buffer containing 20 mM Tris-HCl pH 7.5, 50 mM beta-glycerophosphate, 100 mM KCl, 0.2 mM sodium orthovanadate, 0.2 mM EDTA, 0.2 mM EGTA, 1% Triton X-100, 10% glycerol, 1 mug/ml leupeptin, 1 mug/ml pepstatin, 1 mug/ml antipain, 1 mM benzamidine, and 1 mM DTT. About 50 mug of cell lysate was used for the eIF2B assay, which was performed as described previously . Authors' contributions : Author 1 (MK) carried out all the experiments. Author 2 (CGP) participated in the design and coordination of this study. All authors read and approved the final manuscript. Abbreviations : eIF, eukaryotic initiation factor; eEF, eukaryotic elongation factor; ERK, extra-cellular regulated kinase; GSK-3, glycogen synthase kinase-3; MAPK, mitogen-activated protein kinase; MEK, mitogen-activated protein kinase kinase; m7GTP, 7-methyl guanosine triphosphate; mTOR, mammalian target of rapamycin; PI 3-kinase, phosphoinositide 3-kinase; PHA, phytohemagglutinin; PKB, protein kinase B; PKC, protein kinase C; PMA, phorbol 12-myristate 13-acetate; 4E-BP1, eIF4E-binding protein 1. Backmatter: PMID- 12006105 TI - Management of obstetric anal sphincter injury: a systematic review & national practice survey AB - Abstract | Background | We aim to establish the evidence base for the recognition and management of obstetric anal sphincter injury (OASI) and to compare this with current practice amongst UK obstetricians and coloproctologists. Methods | A systematic review of the literature and a postal questionnaire survey of consultant obstetricians, trainee obstetricians and consultant coloproctologists was carried out. Results | We found a wide variation in experience of repairing acute anal sphincter injury. The group with largest experience were consultant obstetricians (46.5% undertaking >= 5 repairs/year), whilst only 10% of responding colorectal surgeons had similar levels of experience (p < 0.001). There was extensive misunderstanding in terms of the definition of obstetric anal sphincter injuries. Overall, trainees had a greater knowledge of the correct classification (p < 0.01). Observational studies suggest that a new 'overlap' repair using PDS sutures with antibiotic cover gives better functional results. However, our literature search found only one randomised controlled trial (RCT) on the technique of repair of OASI, which showed no difference in incidence of anal incontinence at three months. Despite this, there was a wide variation in practice, with 337(50%) consultants, 82 (55%) trainees and 80 (89%) coloproctologists already using the 'overlap' method for repair of a torn EAS (p < 0.001). Although over 50% of colorectal surgeons would undertake long-term follow-up of their patients, this was the practice of less than 10% of obstetricians (p < 0.001). Whilst over 70% of coloproctologists would recommend an elective caesarean section in a subsequent pregnancy, only 22% of obstetric consultants and 14% of trainees (p < 0.001). Conclusion | An agreed classification of OASI, development of national guidelines, formalised training, multidisciplinary management and further definitive research is strongly recommended. Keywords: Background : The importance of highlighting the problem of incontinence to professionals, and the need to focus on reducing underlying causes is emphasised in recent Department of Health documents . Anal incontinence may be defined as 'faecal or flatus incontinence which is a social or hygienic problem' . There is little doubt that vaginal delivery in general, and obstetric anal sphincter injury (OASI) in particular, are significant contributory factors in the development of anal incontinence . In the UK, anal incontinence in the year after birth is thought to affect nearly 40,000 mothers (1 in 20) annually . Post-partum anal incontinence may affect mothers psychologically as well as physically but many do not seek medical attention because of embarrassment or because they are easily discouraged from discussing it . In one study only one third of individuals with faecal incontinence had ever discussed the problem with a physician . In recent correspondence to the Continence Foundation, a woman describes 'the eternal shame of being with another person when the worst occurs' . The impact of this complication on the vulnerable postnatal mother and her baby is potentially catastrophic. Aside from the potential clinical and social implications there are important medico-legal issues . Furthermore, the treatment of postpartum anal incontinence itself is associated with very high cumulative costs . Perineal trauma after childbirth is of further importance because it lies behind the growing clamour for the right of a woman to choose whether to deliver by elective caesarean section . Obstetric anal sphincter injuries may be seen at the time of birth ('overt') or may be detected only after additional ultrasound investigation, after birth ('occult'). The incidence of 'overt' anal sphincter injury has previously been reported as being between 0.5 --3% of vaginal deliveries . Until recently, anal incontinence not due to 'overt' anal sphincter injury was attributed to pelvic neuropathy . The advent of anal endosonography altered this view by identifying further 'occult' obstetric trauma to the anal sphincter. This has been reported in 35% of primiparous women and a significant association has been demonstrated between these sonographic defects and anal incontinence. However, it has not been established whether these injuries were genuinely 'occult' or whether they had been missed by the doctor or midwife at delivery. There is evidence from one study that perineal anatomy is poorly understood by midwives and trainee doctors, who perform the bulk of deliveries in the UK. In this study, 41% of trainees and 16% of midwives incorrectly classified a partial or complete tear of the EAS as 'second degree'. Inconsistency in classification of tears would allow many injuries to pass, unrecognised. Clearly where an injury occurs, but is not detected, the incidence of anal incontinence may approach 100%. These women will frequently be referred to colorectal surgeons for further evaluation and possible 'secondary' repair. Even with recognition and 'primary' repair, the incidence of anal incontinence has been reported as over 50% and the actual incidence may be even higher . The reasons for the apparently poor outcome after primary repair are not clear, particularly as there is considerable controversy in the literature regarding the optimal obstetric management of OASI. Variation in outcome may be due to different methods and materials being used or to deficiencies in skill and training . Given the sub-optimal outcomes achieved when these injuries are repaired by obstetricians, it has been suggested that better results may be obtained if colorectal surgeons perform the primary surgery . The aims of this study were firstly, to establish the best available evidence for the management of OASI by conducting a systematic review of the literature. Secondly, we aimed to audit current practice amongst trainee and consultant obstetricians. Finally, we wished to explore the views of consultant colorectal surgeons with respect to optimal management of OASI. Methods : Literature review | The Cochrane Library and Cochrane Register of Controlled Trials were searched for relevant Randomised Controlled Trials (RCT), systematic reviews and meta-analysis. A search of MEDLINE and PUBMED (electronic databases) from 1966 up to April 2001 was also carried out. The databases were searched using the relevant MeSH terms, including all sub-headings and this strategy was combined with a Key-word search using -- Human; Female; Childbirth; Obstetric; Perineum; Anal sphincter; Tear; Injury; Rupture; Damage; Incontinence; Faecal; Anal; Repair; Surgery; Sutures; Randomised controlled trials; Meta-analysis. The bibliographies of retrieved articles were searched manually as well as conference proceedings and abstracts from obstetrics and gynaecology and coloproctology meetings. Survey participants | The study sample included all consultant obstetricians & gynaecologists in the Royal College of Obstetricians & Gynaecologists (RCOG) UK database. As a comprehensive national register of obstetric trainees is unavailable, we surveyed all trainee obstetricians in the two regions in which the authors are based (West Midlands and South West Thames regions). We also included all consultant members of the Association of Coloproctology of Great Britain and Ireland. Development of a questionnaire | The postal questionnaire that was sent to the consultant and trainee obstetricians enquired about those aspects of knowledge and practice that our preliminary literature review suggested would be linked to outcome. Questions relating to current experience, classification of perineal injury, acute management, follow-up, management of subsequent deliveries and training received were all included. A similar questionnaire inquiring about the management of primary OASI repair was sent to the consultant coloproctologists. Data processing and analysis | A Freepost envelope was included with the questionnaire. Non-responders received a second questionnaire. Data was entered onto an Access database. The software used for analysis was StatXact Turbo (CYTEL), Cambridge, Massachusetts. The Kruskal-Wallis test was used to compare ordinal data between the 3 groups and chi square tests were applied when the data were nominal. In order to highlight the differences between current evidence and current practice we have presented the results of our literature search in combination with the results of the survey. Results : Respondents | At the time of the survey, 1441 names appeared in the RCOG consultant database (UK) of whom 152 were non-practising obstetricians and 96 had retired. Of the 1193 consultants in active obstetric practice, 672 (56%) completed and returned the questionnaire. Of the 235 trainee obstetricians in the West Midlands and South West Thames regions, 148 (63%) completed and returned the questionnaire. Only 90 (23%) of the 385 members of the Association of Coloproctology replied, despite 2 mailings. The overall response rate was 50.2% (910/1813). The majority of responding consultant obstetricians, 438 (65%) and coloproctologists, 53 (59%) had been in post for more than 5 years. Of the trainee obstetricians-108 (73%) were post-MRCOG. The average numbers of acute OASI repairs (primary) performed annually by consultant obstetricians, obstetric trainees and colorectal surgeons are shown in Table . There were significant differences between the three groups. Table 1 | Number of acute OASI repairs performed per year Definition of OASI | The evidence | The literature review revealed a lack of consistency in the classification of OASI. One study, which examined all the obstetric texts (n= 65) in the RCOG library, found that 22% of authors classified anal sphincter injury as 'second degree' and a further 17% did not mention any classification . Obstetric anal sphincter injury (OASI) is classified as a '3rd degree' tear when there is any involvement of the external anal sphincter (EAS) but when the anal epithelium is involved it is '4th degree' and this was incorporated in the RCOG guidelines on the management of perineal trauma . The RCOG definitions of perineal injury, which are included in the Green Top Guidelines for the Management of Third and Fourth-Degree Perineal Tears Following Vaginal Delivery are shown in Table . A more descriptive classification suggested by Sultan was agreed at a recent consensus meeting on OASI where third degree tears were further classified into three subgroups according to the extent of damage to the external anal sphincter (EAS) and internal anal sphincter (IAS) . Table 2 | Classification of Injury The survey | Two hundred and twenty (33%) consultant obstetricians and 30 (22%) trainees considered a complete or partial external sphincter tear to be 'second degree' . There was widespread regional variation in the 'misclassification' of OASI as 'second degree'. This is emphasised by a ten-fold difference between some regions (higher in the northern regions) in rates of respondents considering a complete EAS tear to be 'second degree' . Table 3 | Classification of perineal tears Table 4 | Geographical variation in the definition of OASI Technique of repair following OASI | The evidence | The most common type of repair is an end-to-end repair, where either interrupted or figure-of-eight sutures are inserted into the sphincter muscle. There is little variation on the standard technique reported. One study described the end-to-end approximation of the anal sphincter, by suturing the outer fascial layer without inserting sutures in the muscle. However, this study has not been reproduced. When employed for secondary repair, mobilisation, scar excision and direct apposition lead to an incidence of sphincter repair disruption of 40% . A modification of an overlapping technique for sphincter repair, described by Parks for the secondary repair of OASI , was first described for acute OASI by Sultan in 1999 . The technique includes identifying the internal anal sphincter which, if torn, is repaired as a separate layer. Using this technique the authors found a significant reduction in anal incontinence (to 8%), which can be compared with 41%, seen in a previous study where the end-to-end technique was employed . There is only one published, prospective randomised study, comparing end-to-end and the overlap techniques . In this series of 112 primiparous women, no significant difference in continence was identified at 3 months' follow-up. The techniques used in this study were different to those described by Sultan . In particular, internal sphincter injury was not identified and repaired separately. There are two ongoing randomised controlled trials comparing the two methods (in Stoke and Liverpool) registered in the Cochrane clinical trials register . The survey | Coloproctologists favour the overlap technique for primary repair of OASI . This technique is reportedly being used by large proportions of obstetricians particularly trainees. Over 55% of responding consultant obstetricians (375/672) and coloproctologists (60/90) said that they would be interested in participating in a trial to compare the two methods of repair. Table 5 | Techniques of external anal sphincter repair Suture material | The evidence | No randomised controlled studies to assess the best suture material for sphincter repair were identified. Most texts that describe the repair still mention the use of chromic catgut . However, monofilament suture materials, such as Polydioxanone (PDS) or Polypropelene (Prolene) are thought to be better than catgut or Polyglactin (Vicryl) because of their longer half life. There is good evidence from randomised trials that synthetic materials such as Vicryl or Polyglycolic acid (Dexon) are preferable to catgut for repair of the perineum . Catgut sutures, made from bovine intestinal material, have recently been withdrawn from UK and European countries. The survey | Vicryl was the material most frequently used for sphincter repair (by 505 (75%) consultant obstetricians and 97 (66%) trainees). By contrast, only 22 (24%) coloproctologists used Vicryl, with greater numbers preferring PDS (41 (46%)). Obstetric experience with PDS was minimal (used by only 51 (8%) consultant obstetricians and 20 (14%) trainees). Antibiotic usage | The evidence | Intra-operative and post-operative broad spectrum antibiotics are recommended because the development of infection may be linked to a breakdown of the anal sphincter repair . Although data exists relating to antibiotic prophylaxis in colorectal surgery there are no randomised controlled studies which examine antibiotic use following OASI repair. The survey | Peri-operative antibiotics were recommended by 82 (91%) coloproctologists and by 528 (79%) consultant obstetricians and 130 (88%) obstetric trainees. Stool softeners | The evidence | A passage of a hard bolus of stool may disrupt repair and therefore most surgical textbooks and experts recommend use of laxatives. However the use of laxatives and stool softeners after OASI repair has not been evaluated in a randomised controlled trial. Indeed medical 'bowel confinement' practised by some colorectal surgeons following secondary anal sphincter repair, has been shown in a randomised trial to confer no benefit in terms of septic complications or functional outcomes . The survey | Stools softeners or laxatives were advised by 70 (78%) coloproctologists. Six hundred and eighteen (94%) consultants and 121 (82%) trainee obstetricians routinely prescribed laxatives following repair. Colostomy | The evidence | In a recent report comprising of 4 patients, temporary defunctioning colostomy has been described when failure to recognise and repair rectal mucosal injury lead to significant early perineal contamination . We could find no studies to support colostomy in the management of acute OASI. A small randomised trial showed no conclusive evidence that a defunctioning stoma confers any benefit for those patients undergoing secondary repair in terms of functional outcome and may be associated with higher morbidity and longer hospital stays related to the stoma closure . The survey | Twenty-seven (30%) coloproctologists recommend a covering colostomy for third and fourth degree tears (of whom 25 said 'only for 4th degree tears'). None of the obstetricians either performed or requested a colostomy for acute OASI. Follow-up | The evidence | There are no controlled trials comparing different protocols. We found two publications suggesting that all women with OASI should be followed-up by coloproctologists . At a recent consensus meeting on OASI follow up in a multidisciplinary clinic was recommended for women with persistent bowel symptoms after delivery. The survey | Coloproctologists suggest a follow-up period of more than 12 months, compared to the majority of obstetricians who follow-up patients for only six weeks . Table 6 | Duration of follow-up after OASI repair Management of subsequent delivery | The evidence | There were no data in the literature from controlled studies regarding the best mode of subsequent delivery following OASI. Evidence that women who experience even transient anal incontinence after vaginal delivery may be at increased risk of faecal incontinence after a further vaginal delivery has lead to calls that such women should be offered caesarean section. However, compared with vaginal delivery caesarean section carries a higher mortality and other forms of morbidity and should therefore not be offered routinely to all women . In the prospective study from Fynes and colleagues , women with transient anal incontinence or occult sphincter injury after first delivery were at high risk of faecal incontinence after a second vaginal delivery. Furthermore it is not clear whether or not pregnancy per se influences postpartum anal incontinence. Symptomatic anal incontinence has been reported after both elective and emergency caesarean deliveries. An alternative approach may be to routinely assess function by means of a continence questionnaire, anorectal physiology tests and endosonography and selectively offer caesarean section to those women with some degree of compromised function. Clearly those who have had successful continence surgery should be delivered by caesarean section . However it remains to be established whether caesarean section would be beneficial to pregnant women with severe incontinence who are due to have continence surgery some time after delivery. The survey | In the present survey most coloproctologists recommended caesarean section. By contrast most obstetricians allowed vaginal delivery after a previous OASI. Table 7 | Mode of subsequent delivery: Role of the coloproctologist in the management of OASI | The evidence | Although some authors suggest that coloproctologists are best trained to repair OASI, there are no data to support this statement and the debate continues . The survey | In the present survey only small numbers of consultants (103 (15%)), and fewer trainees (5 (3%)), called a coloproctologist or a general surgeon to assist during acute OASI repair, the indication in these cases being 'severe anatomical disruption'. Few of the respondents believed that a coloproctologist should be routinely involved in acute management of OASI; 17 (19%) coloproctologists, 169 (25%) consultants and 16 (11%) trainees). Training received in the management of OASI | The evidence | There are no research studies comparing different methods of training. There is only one study that has evaluated training in repair of OASI . Ninety four percent reported unsatisfactory training at the time of performing their first unsupervised OASI repair. The survey | 445 (64%) consultants and 184 (64%) trainees reported either 'a lack of' or 'unsatisfactory' training in the management of OASI. Discussion : Our literature review and national survey have shown that obstetric anal sphincter injury is an area of childbirth that has been largely ignored, in both research and educational terms. There is a poor evidence base for practice and there has been only one published randomised controlled trial in this area. Our survey had a good obstetric response rate but a poor response from the colorectal surgeons (this may be attributed to the fact that, only about one third of coloproctologists have a specialised interest in anorectal incontinence). Our survey shows wide variation within specialities, levels of seniority and different regions of the country. These findings were echoed at a national professional consensus which highlighted the importance of research into anal incontinence, including the problems of failed recognition and uncertainty about the best method of repair . There are two probable reasons for the underestimation of OASI. Firstly, as a result of lack of a consistent classification, OASI can be wrongly classified as a 2nd degree tear and therefore managed inappropriately. We found that 33% of consultants and 22% of trainees classified a partial or complete tear of the EAS as 'second degree' which echoes the previous smaller study by Sultan . One reason for misclassification may be a degree of confusion created by popular obstetric texts . Our analysis of the regional trends in classification indicates that more consultants in the Northern regions of the country prefer to classify OASI as 2nd degree. This may reflect the teaching in a popular obstetric textbook . To avoid confusion we support the unified and descriptive classification given by Sultan in which third degree tears are further sub-classified into 3a (less than 50% of thickness of external sphincter torn), 3b (more than 50% of thickness of external sphincter torn) and 3c (internal sphincter torn). Figure 1 | Regional variation of the definition of anal sphincter injury Regional variation of the definition of anal sphincter injury Secondly, underestimation may be due to lack of recognition of OASI because of lack of training. A recent study has shown that immediate assessment of all perineal tears following childbirth by a trained and experienced obstetrician can significantly increase the detection rate. In this study, rates of up to 15% were found, which might provide an explanation for the high incidence of 'occult' sphincter defects reported in previous prospective studies . We have recently presented national data showing nearly a hundred fold variation in detection rates of OASI . The reason for the poor outcome following repair can be attributed to inappropriate technique or to lack of operator expertise or to a combination of these factors. Despite a primary repair of acute obstetric anal sphincter injury, up to 59% of women suffer from persistent anal incontinence and persistent sonographic sphincter defects have been identified in over 80% . Anal incontinence may present for many years following OASI and can also deteriorate with time. Schofield and Grace have looked at the differential rates of the components of anal incontinence (faecal incontinence and flatus and urgency) in five studies which examined these outcomes after primary repair of third degree tears. The intervals of follow-up ranged from 6 weeks to 10 years. The overall mean rates were 25% (flatus +/- urgency) and 9% (faecal incontinence). The longer the follow-up, the higher the rate of incontinence. We have identified another 11 studies with long term follow-up (a mean of 41 months) after 3rd degree tears and 20 to 59% (mean 40%) reported anal incontinence symptoms . Responses to this national survey showed the principle area of disagreement to be 'the optimal method of repair'. However, the fact that half of all obstetricians now claim to be using the 'overlapping' method suggests that there is a change in practice taking place, despite the absence of good quality evidence to support this. Given that untutored use of the overlap method could potentially increase morbidity (as it requires more dissection and mobilisation prior to repair and could also result in a sphincter which is too tight), this may be considered an area of concern. In a recent 5 year follow-up study of incontinent women who had a secondary overlapping repair for obstetric trauma , although 50% improved only 4 of 38 patients were totally continent. The overall success of the overlap method 'seemed to deteriorate with time'. The authors wondered whether the technique itself contributed to this deterioration. Clearly there is an urgent need for further properly controlled trials of method of repair, with adequate long-term follow-up. As shown in our survey, there is a widespread interest in participating in a controlled trial in this area. If advantage is taken of this 'window of opportunity', considerable benefits for women should arise. The finding that only one third of UK consultant obstetricians reported that they were adequately trained to perform anal sphincter repairs requires further attention as this may well have serious clinical and medico-legal implications . We believe that obstetricians need more intensive and focused training in OASI and repair. A series of hands-on-workshops in the management of OASI, utilising a specifically designed model and animal models, has been initiated at St George's Hospital, London. Although it has been suggested that as colorectal surgeons are trained to perform a secondary sphincter repair they should be performing the primary repairs, there was little evidence that current systems could support such a significant change in organisation. Indeed, our survey showed that most coloproctologists have little or no experience of managing acute OASI. A lack of understanding of the circumstance of childbirth by coloproctologists may explain why 30% believed that a colostomy is appropriate management. Further interdisciplinary co-operation is clearly required. It is apparent from our survey that most obstetricians use Vicryl sutures and antibiotics, and prescribe stool softeners after repair. The ideal suture material for primary sphincter repair is not known although good results have been described using a delayed absorbable monofilament material such as PDS and some surgeons prefer prolene. Further research in this area is required. Given the large proportions of women who may suffer impaired anal continence even following repaired OASI, it is imperative to establish a system for follow-up. Further research into the most efficient and effective systems is required. Increasing awareness amongst women and community health professionals about the possible sequelae of OASI is important and easy access for appropriate follow-up and further investigation is essential. There is no evidence to indicate the ideal and safest mode of subsequent delivery. Until further research has been undertaken individual cases will need to be managed empirically. Where there has been secondary surgery or where symptoms have taken some time to improve the threshold for elective caesarean section will be lower. Conclusions : To encourage women to consider vaginal delivery positively, adverse outcomes need to be minimised. The results of our literature review and professional survey are informing the development of national guidelines based on current available best evidence . Support for research in this area has a broad mandate and reflects a need noted by both the research community and the research consumer . Randomised controlled trials of overlap versus end-to-end repair are currently underway . It is clearly of great importance that this research is supported and that further studies addressing the detail on training, prevention, recognition and management of OASI are commenced. Competing interests : None declared. Appendix : What is known about the subject / What the paper adds | Appendix see : Appendix Anal Sphincter Paper Authors' contributions : This study was conceived by RF, RJ, AS and SR. RF, RJ, AS, SR and PJ contributed to the design of the study. RF carried out the survey and data collection. RF and PJ analysed the data. The paper was written jointly by all authors. RF and RJ act as guarantors for this paper. Pre-publication history : The pre-publication history for this paper can be accessed here: Backmatter: PMID- 12052260 TI - Mutational analysis of human profilin I reveals a second PI(4,5)-P2 binding site neighbouring the poly(L-proline) binding site AB - Abstract | Background | Profilin is a small cytoskeletal protein which interacts with actin, proline-rich proteins and phosphatidylinositol 4,5-bisphosphate (PI(4,5)-P2). Crystallography, NMR and mutagenesis of vertebrate profilins have revealed the amino acid residues that are responsible for the interactions with actin and poly(L-proline) peptides. Although Arg88 of human profilin I was shown to be involved in PI(4,5)-P2-binding, it was suggested that carboxy terminal basic residues may be involved as well. Results | Using site directed mutagenesis we have refined the PI(4,5)-P2 binding site of human profilin I. For each mutant we assessed the stability and studied the interactions with actin, a proline-rich peptide and PI(4,5)-P2 micelles. We identified at least two PI(4,5)-P2-binding regions in human profilin I. As expected, one region comprises Arg88 and overlaps with the actin binding site. The second region involves Arg136 in the carboxy terminal helix and neighbours the poly(L-proline) binding site. In addition, we show that adding a small protein tag to the carboxy terminus of profilin strongly reduces binding to poly(L-proline), suggesting local conformational changes of the carboxy terminal alpha-helix may have dramatic effects on ligand binding. Conclusions | The involvement of the two terminal alpha-helices of profilin in ligand binding imposes important structural constraints upon the functions of this region. Our data suggest a model in which the competitive interactions between PI(4,5)-P2 and actin and PI(4,5)-P2 and poly(L-proline) regulate profilin functions. Keywords: Background : The small actin binding protein profilin has multiple binding partners and is thought to play a key-role in the regulation of actin dynamics . Originally, profilin was identified as an actin sequestering protein but recently more complex effects on actin polymerization have been proposed because actin-profilin complexes can add to free barbed ends thereby stimulating actin polymerization . Profilins bind poly(L-proline) sequences and many proteins containing proline-rich stretches have been identified as profilin ligands. Of these the interaction with the enabled/vasodilator stimulated phosphoprotein (Ena/VASP) family is best documented . For several proline-rich proteins a direct link with signal transduction pathways has been described , thus positioning profilins at crossroads of multiple pathways that lead to actin remodeling . With the elucidation of the profilin-beta-actin crystal structure, the residues at the interface of both proteins were identified . Additionally, crystalographic, mutagenesis and spectroscopic studies have addressed the poly(L-proline) binding site and showed that a hydrophobic pocket between the amino and carboxy terminal alpha-helices forms the binding site for poly(L-proline) sequences [,-]. The interaction of profilin with phosphatidylinositol lipids has been functionally studied. In vitro, PI(4,5)-P2 dissociates actin:profilin complexes and these and other authors also demonstrated the specificity of the interaction between profilin I and PI(4,5)-P2 in both micellar form as well as in lipid vesicles . More recently it was shown that phosphatidylinositol (3,4)-bisphosphate and phosphatidylinositol (3,4,5)-triphosphate bind to profilin with even higher affinity than PI(4,5)P2 and that phosphatidylinositol (3,4,5)-triphosphate inhibits profilin sequestering activity much better than PI(4,5)P2. In addition, PI(4,5)-P2, bound to profilin, can only be hydrolyzed by phospholipase Cgamma1 (PLCgamma1), when this lipase is phosphorylated and activated, which occurs in response to transmembrane signaling . This leads to two, not mutually exclusive scenarios that profilins are involved in phosphoinositide metabolism or that PI(4,5)-P2 hydrolysis causes translocation of profilin from the membrane to the cytosol where it can interact with actin or other ligands. This suggests an important role for profilin-phosphoinositide interaction in vivo. The structural basis for this interaction is, however, only partly resolved (see below). The interaction of actin binding proteins with PI(4,5)-P2 is usually assigned to the binding of the negatively charged headgroup of the phoshoinositide to basic amino acids. In agreement with this is that the more positivily charged Acanthamoeba profilin II isoform has highest affinity for PI(4,5)-P2. Similarly, the more basic human profilin I isoform interacts better with PI(4,5)-P2 than does profilin IIa . The identity of the amino acids responsible for binding of profilins to PI(4,5)-P2 is a matter of debate, because there are discrepancies between studies on profilins from lower eukaryotes and from vertebrates . Based on comparison of the crystal structure of the two Acanthamoeba profilin isoforms, Fedorov and co-workers proposed that a surface with positive electrostatic potential, formed by residues 71, 80, 81 and 115 (corresponding to residues 74, 88, 90 and 125 in human profilin), was the main PI(4,5)-P2 binding site in Acanthamoeba profilin. This surface largely overlaps with the actin binding surface and hence this model explained the observed competition between actin and PI(4,5)-P2 for binding to profilin . Mutagenesis of the yeast homologue partially confirmed this model as residue 71, but not residue 80, is implicated in phosphoinositide binding . Based on the structural model, we previously suggested that Glu56 in mammalian profilin IIa would be responsible for the weaker interaction of this isoform because the negative charge of this residue reduces the large, positively charged surface around the hypothetical PI(4,5)-P2-binding site . In profilin I, which has a serine at position 56 this is less the case. In human profilin, however, only Arg88 and not Arg74, was argued to be involved in PI(4,5)-P2-binding since only the mutant in Arg88 showed decreased inhibition of PI(4,5)-P2 hydrolysis by PLCgamma . We and others have speculated that basic residues in the carboxy terminal alpha-helix of vertebrate profilins may be involved in PI(4,5)-P2-binding. First, Yu and coworkers postulated that the residues 126 to 136 (KCYEMSHLRR) of human profilin I are a modified version of the PI(4,5)-P2-binding motif in gelsolin (KSGLKYKK). Second, using photoactivatable homologues of PI(4,5)-P2, it was hypothesized that carboxy terminal basic residues in human profilin I are involved in contacting the negative headgroups of PI(4,5)-P2. Third, the observed competition between poly(L-proline) and PI(4,5)-P2 for binding to profilin is consistent with the proposal that the carboxy terminus of profilin is involved in PI(4,5)-P2-binding . Fourth, we have shown that mammalian profilins I and IIa have clearly different affinities for PI(4,5)-P2, even though their actin binding surface including Arg74 and Arg88, are well conserved. This suggests that still other residues must be involved in PI(4,5)-P2-binding. In this study we experimentally investigated this hypothesis using site directed mutagenesis of human profilin I. Our data clearly show that, in addition to Arg88, also Arg136 in the carboxy terminal helix has a major contribution to PI(4,5)-P2-binding. Given that mutant R136D, but not R88A, displays wild type actin binding activity, we propose that the PI(4,5)-P2 and actin binding sites only partly overlap. Our data also suggest a connection between PI(4,5)-P2-binding and the interaction with proline-rich ligands, since the profilin IIa mutant W3A, defective in poly(L-proline) binding shows increased PI(4,5)-P2-binding. Given the observed conformational changes upon poly(L-proline) and PI(4,5)-P2-binding we propose that correct orientation of the terminal alpha-helices is important for ligand binding. This is strengthened by the fact that the addition of a myc tag to the carboxy terminal helix of profilin IIa abolishes poly(L-proline) binding completely. Results and discussion : Mutational analysis of human profilin I | The goal of this study was to get a better insight into the structural basis of the interaction of vertebrate profilins with PI(4,5)-P2. To investigate the possible role of the above mentioned residues (see Background) in PI(4,5)-P2-binding and to obtain profilins that have reduced PI(4,5)-P2-binding capacity, we created a set of single and double mutants in the residues Ser56, Arg74, Arg88, Arg135 and Arg136 of human profilin I (Figure and Table ) and a mutant W3A defective in poly(L-proline) binding. Figure 1 | Three dimensional structure of human platelet profilin I (PDB entry, 1 fik). Three dimensional structure of human platelet profilin I (PDB entry, 1 fik). Helices are shown in red, beta-strands in blue, beta-turns in green and loops in grey. Residues mutated in this study are indicated with space filling: Trp3 in yellow (poly(L-proline) binding), Ser56 and Arg135 in pink, Arg 74 in green (actin binding), Arg88 and Arg136 in blue (PI(4,5)-P2 binding). Table 1 | Interaction of wild type and mutant profilins with a proline-rich peptide Wild type human profilin I as well as the mutants listed in Table were expressed in E. coli and all could be purified by poly(L-proline) affinity chromatography, except for the W3A mutant which does not bind poly(L-proline) (see below). We initially included the R88E mutant, but due to its instability, we were unable to purify this protein in sufficient amounts for biochemical analysis. Mutants have a similar fold and stability as wild type profilin I | We first probed whether the introduced mutations did not affect the conformation and stability by analyzing the conformational integrity of the mutants using circular dichroism (CD) spectra. We measured and compared spectra for wild type and mutant profilins between 184 and 260 nm . All mutants adopt a very similar fold as wild type profilin I. The wavelengths at which maximal and minimal peak values are observed do not or only slightly change. The small shoulders at lower wavelength, observed for the double mutants with R136D, suggests that mutation of this residue to aspartic acid affects in some way the stability or the position of the carboxy terminal alpha-helix. The differences are however too small to be interpreted quantitatively. Figure 2 | Circular dichroism spectra show that the mutants have a similar fold as wild type profilin I. Circular dichroism spectra show that the mutants have a similar fold as wild type profilin I. The molar ellipticity per residue weight is shown. The spectra of several single mutants (A) and of double mutants with altered PI(4,5)-P2 binding (B) are compared with that of wild type profilin I. To further test the stability of the mutants, especially the ones that show greatly altered binding to PI(4,5)-P2 (see below), we measured urea denaturation curves . For R136D and R88A/R136D we observed a very small shift of the transition to lower urea concentration when compared to wild type profilin I. On the contrary, R88E/R136D, which has the most pronounced phenotype (see below) displays a denaturation curve very similar to that of wild type profilin I. Together, these data show that the mutants are stable and correctly folded under the conditions used in the assays described below. Figure 3 | Urea denaturation curves for human profilin I and the three mutants that have strongly reduced PI(4,5)-P2 binding. Urea denaturation curves for human profilin I and the three mutants that have strongly reduced PI(4,5)-P2 binding. For each profilin the ratio of the intrinsic fluorescence (F) at two different wavelengths F(352 nm)/F(332 nm) is plotted versus the urea concentration. Wild type profilin I (closed squares), R136D (open circles), R88A/R136D (open triangles), R88E/R136D (closed circles). The inserted table lists the urea concentration at the midpoint of the fluorescence transition. These values are a measure for the stability of the proteins. Poly(L-proline) binding | To sensor more subtle effects on the poly(L-proline) binding of the mutants, we used surface plasmon resonance technology to monitor the binding of the mutants to the (GP5)3 peptide derived from VASP. The measured reasonance units (RU) for each mutant at three different concentrations are given in Table . Although it is not possible to calculate a Kd for profilin I by this method , from the obtained RU-values we can deduce relative affinities for the mutants as compared to wild type profilin I . The most severe effects are observed for R135D, R136D and double mutants containing one of these mutations. This is logical because Arg135 and Arg136 are located in the carboxy terminal alpha-helix, which is involved in poly(L-proline) binding. These residues do, however, not directly contact the proline-rich peptide nor do they stabilize any of the crucial poly(L-proline) binding residues . Instead they are oriented outward, away from the poly(L-proline) moiety in the co-crystal. Therefore, the mutations may induce a conformational change in the carboxy terminal helix, which distorts correct orientation of the poly(L-proline) binding residues. But as judged from the CD-spectra and modeling experiments, this structural change is probably very subtle . In addition, mutations may inhibit or facilitate the previously observed conformational changes that occur in profilin upon binding of poly(L-proline) . Even though mutations at positions 56, 74 or 88 and combinations thereof are distant from the poly(L-proline) binding site, they also result in lowered poly(L-proline) binding. Remarkably, mutations in this region in yeast profilin caused a similar phenotype . Apparently these mutations cause allosteric conformational changes, resulting in less efficient binding of the proline-rich peptide. Interaction of mutants with actin | We determined the dissociation constants of our mutants for alpha-skeletal muscle actin using capped filaments . Under these conditions, profilin displays only G-actin sequestering activity. In addition, we studied the effect of each mutant on non-steady state actin polymerization . To analyze the obtained curves we determined the amount of F-actin formed at a time point (indicated in Figure as T1/2) where the amount of F-actin in the absence of profilin is 50% of the amount formed after 1500 sec. In the presence of WT profilin I, only 12% of F-actin is formed at this time point. The values for the mutant profilins are given in Table . Figure 4 | Time course of alpha-actin polymerization in the absence or presence of several mutant profilins. Time course of alpha-actin polymerization in the absence or presence of several mutant profilins. 10 muM actin and 5 muM profilin are pre-incubated prior to addition of KCl and MgCl2 to a final concentration of 100 mM and 2 mM, respectively. Curves for actin alone (closed triangles), or in the presence of either wild type profilin I (closed circles), R74E (open squares), R136D (open circles) are shown. T1/2 is the time point where the F-actin amount in the actin alone sample reaches 50% of the total F-actin formed after 1500 sec. For each profilin I mutant the percentage of F-actin at T1/2 is determined and given in Table . Table 2 | The interaction of wild type and mutant profilins with alpha-actin. We could not calculate a Kd value for R74A, R74E, S56E/R74E, S56E/R74A and R74E/R88E because the concentration of the actin-profilin complex was nearly zero, leading to very high Kd estimates. This is consistent with the observation that these mutants have no activity in the time course polymerization assay. As determined from the crystal structure of the actin-profilin complex and mutagenesis studies , Arg74 is a crucial residue for actin binding, since it forms a salt bridge with the carboxyl group of Phe375. Consequently, changing the arginine to an alanine or glutamic acid abolishes this interaction completely. Arg88 is also part of the actin-profilin interface, but changing it to alanine decreases the affinity only three-fold, indicating that the binding is less stringent than for Arg74. Mutating Arg88 to leucine or to glutamic acid in combination with S56E (which on its own has no effect), however, abolished actin binding completely. Arg135 and Arg136 locate in the carboxy terminal helix on the opposite side of the molecule and do not participate in actin binding. As a consequence, mutations in these residues do not affect the affinity for actin to a significant extent (Figure and Table ). PI(4,5)-P2 binds to two distinct regions in human profilin I | We used microfiltration and gel filtration to assay the ability of the mutants to bind PI(4,5)-P2 (Figure , Table ). The results of both assays were comparable. Based on analogy with invertebrate profilins (see background) and combined with sequence comparison of profilin I and IIa, we expected S56E to contribute negatively to PI(4,5)-P2-binding. This is, however, not the case and thus this amino acid difference between profilin I and IIa cannot explain the different affinities of the two profilin isoforms for PI(4,5)-P2. A further difference with invertebrate profilins is the observation that mutating Arg74 to leucine, glutamic acid or alanine (this study and ) does not significantly affect PI(4,5)-P2-binding. Since substitution to an acidic residue at this position results in only a slight effect, we consider the contribution of Arg74 in PI(4,5)-P2-binding to be of minor importance. Consequently, also the double mutants S56E/R74A and S56E/R74E show nearly wild type PI(4,5)-P2-binding. Previously, it was shown that Arg88 is involved in PI(4,5)-P2-binding of human profilin I , in agreement with several crystal structures showing a phosphate or sulfate anion associated with Arg88 and surrounding residues . In our assays, R88A has a small effect on PI(4,5)-P2-binding . Unfortunately we were unable to purify mutant R88E for which we expected a more pronounced phenotype. The effect of the latter mutation can, however, be inferred from the double mutants R74E/R88E and S56E/R88E. Both mutants show reduced PI(4,5)-P2-binding, compared to S56E, R74E and S56E/R74E which display nearly wild type binding capacity . Figure 5 | PI(4,5)-P2-binding of profilin mutants. PI(4,5)-P2-binding of profilin mutants. A. Microfiltration of profilin-PI(4,5)-P2 complexes. 4 muM profilin is incubated with increasing concentrations of PI(4,5)-P2 as indicated and applied to a filter with MWCO of 30.000. Non-bound profilin passes through the filter upon centrifugation. The flowthrough is analyzed by SDS-PAGE and is shown here for wild type profilin, R135D, R136D and R135A/R136A. B. Examples of gel filtration experiments. Profilin (10 muM) was pre-incubated with increasing concentrations of PI(4,5)-P2 and run over a SMART Superdex75 gel filtration column. Free profilin elutes at 1.62 ml, while the profilin-PI(4,5)-P2 complex elutes in the void (0.96 ml). The profilin peak shifts to the void fraction upon binding to PI(4,5)-P2. Elution pattern of wild type profilin alone (black line), profilin with 40 muM PI(4,5)-P2 (dark grey line) and profilin with 150 muM PI(4,5)-P2 (light grey line) are shown. We calculated the peak surface of free profilin to determine the percentage of bound profilin for different PI(4,5)-P2 concentrations. These data were then plotted in curves as shown in C. C. Percentage of bound profilin in function of PI(4,5)-P2 concentration as determined from the gel filtration curves. Wild type profilin (closed circle), R136D (open circle), R88A (closed triangle), R88A/R136D (open triangle) and R88E/R136D (closed square) in the gel filtration experiment. The concentration of PI(4,5)-P2 where 50% of profilin is bound to the micelles was derived from these curves and is given in Table for the different mutants. Table 3 | PI(4,5)-P2-binding of mutants assayed by gel filtration Interestingly, mutant R136D has a more pronounced effect than R88A (Figure and Table ). In contrast, mutating the neighboring residue Arg135 has only a small effect on PI(4,5)-P2-binding. Combining mutations in Arg88 and Arg136 has an additive effect : R88A/R136D and R88E/R136D show a much larger reduction in PI(4,5)-P2-binding than the single mutants . This suggests that the reduced PI(4,5)-P2-binding seen for R136D is due to a direct loss of an interaction. Although we cannot exclude contribution from allosteric effects, modeling experiments substituting R136 with an aspartic acid (data not shown) show no significant change in position of the side-chain or of the carboxy terminal alpha-helix. We conducted gel filtration experiments at high profilin to PI(4,5)-P2 ratio's for wild type profilin I and the R136D mutant to assess if the mutation affects overall saturable binding ability. This seems, however, not to be the case (data not shown), since we found for both wild type and mutant a ratio of ten profilin molecules per PI(4,5)-P2 micelle, suggesting a stoichiometry of 1:8 profilin : PI(4,5)-P2 molecules, consistent with a previous report . Depending on the assay conditions used, variable values for the stoichiometry of the profilin : PI(4,5)-P2 complex were found, varying between 1:4 and 1:10 . Given this 1:8 stoichiometry, it is difficult to observe the loss of one interaction using PI(4,5)-P2 micelles. We note, however, that in case of the mutant higher concentrations of profilin and PI(4,5)-P2 than for wild type profilin were required to obtain saturation, in agreement with the lower affinity of this R136D mutant Lassing and Lindberg showed that the inhibition on actin polymerization of wild type human profilin I decreases in the presence of PI(4,5)-P2. If Arg136 is involved in PI(4,5)-P2-binding, then this mutant should be less affected in its inhibitory activity in the presence of PI(4,5)-P2. This is indeed what we observe . R136D behaves similar to wild type profilin I in the absence of PI(4,5)-P2 (Figure and ). In the presence of a 9-fold molar excess of PI(4,5)-P2 we observe, however, a significant difference. For R136D we measure only a small reduction in sequestering activity compared to an almost complete inhibition of the sequestering activity of wild type profilin I. In the presence of a 25-fold molar excess of PI(4,5)-P2, however, R136D loses its sequestering activity completely (data not shown), indicating that the mutation did not entirely abolish PI(4,5)-P2-binding. This is consistent with the results from the gel filtration experiment and implicates a role for other residues such as Arg88. Figure 6 | PI(4,5)-P2 inefficiently competes with actin for binding to R136D profilin I. PI(4,5)-P2 inefficiently competes with actin for binding to R136D profilin I. The curves shown are : 8 muM Mg2+-ATP-G-alpha-actin (5% pyrene labeled) alone (closed triangles) or with 4 muM wild type profilin I (closed circles), 4 muM R136D (open circles), 4 muM wild type profilin I and 36 muM PI(4,5)-P2 (closed squares), 4 muM R136D and 36 muM PI(4,5)-P2 (open squares). Recently we demonstrated that profilin IIa has a lower affinity for PI(4,5)-P2 than profilin I . This can be explained with the data presented in this paper. In profilin I, Arg136 is important for PI(4,5)-P2-binding. In profilin IIa, there is an aspartic acid at this position (Asp136) and the profilin I R136D mutant thus mimics the profilin IIa isoform with respect to PI(4,5)-P2-binding. An indirect role of tryptophan 3 in PI(4,5)-P2-binding | Based on experiments with photoactivatable PI(4,5)-P2 analogues, Chaudhary and coworkers (1998) suggested that hydrophobic residues in the amino terminal helix are involved in the interaction with PI(4,5)-P2. Trp3, the fluorescence of which is quenched in the presence of PI(4,5)-P2, is spatially close to Arg136 (see Figure ). Therefore we mutated the former residue to alanine, thereby reducing the hydrophobic moiety. Trp3 is a crucial residue for the interaction of profilin with poly(L-proline) [,-,] and as expected the W3A mutants of profilin I and IIa lack poly(L-proline) binding and were thus purified using alternative methods (see Materials and Methods). The dissociation constant for the actin-profilin I W3A-complex was similar to that of wild type profilin I . The profilin I W3A mutant did not show a significant decrease in PI(4,5)-P2-binding, suggesting this residue does not directly contribute to the interaction. Interestingly, the profilin IIa W3A mutant shows increased affinity for PI(4,5)-P2 and the affinity is comparable with that of wild type profilin I . Given the profilin I W3A data presented here and in view of the conformational changes observed upon ligand binding , we propose that mutating Trp3 in profilin IIa promotes/induces a conformation which is more competent for PI(4,5)-P2-binding (see below). Figure 7 | Profilin IIa W3A mutant has increased affinity for PI(4,5)-P2. Profilin IIa W3A mutant has increased affinity for PI(4,5)-P2. Percentage of bound profilin in function of PI(4,5)-P2 concentration as determined from gel filtration experiments described in Figure . The concentration of PI(4,5)-P2 where 50% of profilin is bound to the micelles was derived from these curves and is given in Table . Model for regulation of profilin-ligand interactions | The data presented here show that in addition to Arg88, Arg136 is involved in PI(4,5)-P2-binding of mammalian profilin I. Based on our quantitative gel filtration assay, the contribution of Arg136 is in fact more important than that of Arg88 and the double mutant hardly binds PI(4,5)-P2 micelles. We conclude that the PI(4,5)-P2 binding sites of profilin are located in two distinct regions of the molecule that are approximately 31 A apart (see Figure ). It is remarkable that there are no corresponding positively charged residue(s) in the carboxy terminus of yeast and Acanthamoeba profilins that could account for a similar interaction as found here for human profilin I. This may indicate that the structural basis for the interaction of PI(4,5)-P2 with profilins from lower and higher eukaryotes is partially different. We also note that Acanthamoeba profilin II has a ten fold lower affinity for PI(4,5)-P2 than human profilin I . Both PI(4,5)-P2-binding regions in vertebrate profilins are implicated in the interaction with another profilin ligand. Arg136 is close to several poly(L-proline) binding residues. Not surprisingly, mutations in Arg136 have also strongly decreased poly(L-proline) affinity, although Arg136 itself is not directly contacting proline-rich ligands. On the other hand, Arg88, involved in PI(4,5)-P2-binding is also part of the actin binding site . A partial overlap of actin- and PI(4,5)-P2-binding sites was also observed for actophorin and gelsolin , suggesting this is the basis for a general regulatory mechanism for several actin binding proteins, whose function is inhibited by PI(4,5)-P2. Our data thus offer an explanation for the previously observed competition between PI(4,5)-P2 and the two other profilin ligands : actin and poly(L-proline) . This offers a nice model for the regulation of profilin with its different ligands. Since PI(4,5)-P2 inhibits both actin and poly(L-proline) binding , it is conceivable that PI(4,5)-P2 may have a master regulatory function in the cell. When PI(4,5)-P2 is hydrolyzed after cell stimulation, profilin may be set free to interact both with proteins containing proline-rich regions and with actin to regulate actin dynamics. The concerted action in vivo of profilin-actin complexes with several proline-rich proteins such as Ena/VASP proteins, N-WASP and formins for the promotion of actin polymerization was suggested previously . Several of our mutants suggest allosteric communication within vertebrate profilins. Arg88 mutants have reduced poly(L-proline) binding, although this residue is not part of the poly(L-proline) binding pocket. Conversely, W3A (in profilin IIa) influences PI(4,5)-P2-binding, but appears not to be directly involved in PI(4,5)-P2-binding as suggested by the data on profilin I W3A, although a W3N mutation in profilin I results in a higher affinity for PI(4,5)-P2. These results suggest that the interaction of profilin with PI(4,5)-P2 and poly(L-proline) involve conformational changes, which have been experimentally observed before . The interaction of profilin with PI(4,5)-P2 induces an increase in alpha-helical content . We propose that the local structure of the neighboring binding sites may change upon binding of PI(4,5)-P2 and poly(L-proline). The fact that W3A of profilin I binds PI(4,5)-P2 similar to wild type, suggests that profilin I already has the correct conformation for optimal binding of PI(4,5)-P2 and that mutating Trp3 to alanine does not ameliorate this conformation further (see also below), while an asparagine at position 3 does have a positive effect . In contrast, the W3A mutation in profilin IIa increases the affinity for PI(4,5)-P2, suggesting that this mutation induces a conformational change which optimizes the interaction with PI(4,5)-P2 despite the presence of an aspartic acid at the nearby position 136. The profilin IIa structure is, however, optimal for strong poly(L-proline) binding. In modeled and energy minimized profilin IIa structures we observed that the terminal alpha-helices are further apart from each other suggesting better access to the poly(L-proline) binding cleft . From this point of view, it is logical to assume that changing the position of these terminal alpha-helices has dramatic effects on ligand binding. This idea is consistent with our observation that the addition of a myc-tag to the carboxy terminal end of profilin IIa results in the dramatic loss of poly(L-proline) binding despite the fact that all known proline interacting residues are present . The suggested conformational change in profilin IIa-myc does, however, not significantly influence the affinity for actin . Similarly, mouse profilin IIb, which has six additional amino acids at its carboxy terminus, does not bind poly(L-proline) . In addition, it has been reported that both amino- and carboxy terminal GFP fusion proteins of mammalian profilins display a dramatic loss in poly(Lproline) binding . Some fusion proteins even lack complete poly(L-proline) binding. Therefore we believe that the correct positioning of the terminal alpha-helices of profilin is a primary requirement for ligand interaction. It is clear that any distortion of the alpha-helices will reduce the interaction with poly(L-proline). Figure 8 | Addition of carboxy terminal myc-tag to profilin IIa dramatically reduces poly(L-proline) binding. Addition of carboxy terminal myc-tag to profilin IIa dramatically reduces poly(L-proline) binding. A. Biacore binding curves for 100 muM wild type profilin IIa (blue), 1 muM wild type profilin IIa (green), or 100 muM profilin IIa-myc (red) to the (GP5)3 peptide derived from VASP. Resonance units (R.U.) are a measure for the number of profilin molecules retained by the peptide on the sensor chip and this is also concentration dependent (see B.). Even at a 100 times higher concentration, profilin IIa-myc (100 muM) binds less efficient to the peptide than wild type profilin IIa (1 muM). B. R.U. values obtained with different concentrations of wild type profilin IIa and profilin IIa-myc. Note that the value for 100 muM wild type profilin IIa is different from the one in Table , due to a different amount of peptide coupled to the sensor chip. Conclusions : We have identified Arg136, besides the previously identified Arg88, of human profilin I as an important residue for the interaction with PI(4,5)-P2. Since Arg136 is part of the poly(L-proline) binding helix and Arg88 is located in the actin binding surface, we suggest that the interaction of profilin with its different ligands is regulated by competitive interactions, which may be partly allosteric. Our results also indicate that the position of the two large terminal alpha-helices is crucial for optimal ligand binding. The addition of (protein or peptide) tags to the carboxy terminus results in dramatic decreased affinity for poly(L-proline) ligands. Conceivably, this will result in altered interactions in cells and in vivo data obtained with tagged profilin isoforms should be carefully (re)interpreted. Materials and methods : Profilin mutagenesis and purification | The profilin I cDNA amplified by polymerase chain reaction from a human cDNA library was subcloned into pET11d . Site directed mutagenesis was performed by polymerase chain reaction with mutated oligonucleotide primers and pfu polymerase. Mutations were verified by sequencing. MC1061 E. coli harboring the pT7POL26 plasmid were used for expression of wild type and mutant profilin I, Proteins were subsequently purified by poly(L-proline) affinity chromatography . W3A mutants do not bind poly(L-proline), thus the flow-through of the poly(L-proline) column was loaded onto a DEAE column equilibrated in buffer A (20 mM Tris-HCl, pH 8.1, 1 mM EDTA, 1 mM DTT). The column was eluted with a 0 to 500 mM NaCl gradient in buffer A. Profilin eluted with 60 to 130 mM NaCl. The profilin containing fractions were pooled and loaded on a MonoQ column. The flowthrough of this column contained profilin and only very few other proteins. These contaminating proteins were then removed by gel filtration in buffer A. Other Protein preparations | We purified actin from rabbit skeletal muscle and isolated it as calcium G-actin by Sephadex G200 chromatography in G-buffer (5 mM Tris-HCl, pH 7.7, 0.1 mM CaCl2, 0.2 mM ATP, 0.2 mM dithiothreitol, 0.01% sodium azide) . Actin was pyrene labeled on cysteine 375 . Gelsolin was purified from human plasma . Circular dichroism | We performed CD measurements in the far UV region (184 --260 nm) for WT and mutant profilins at a concentration of 15 muM in 7 mM TRIS/HCl, pH 8 in a JASCO J-170 spectropolarimeter using a 1 cm pathway cell. The step resolution was 0.5 nm and the scan speed 20 nm/min. For each sample the average of 9 scans was obtained and spectra were normalized for concentrations. Denaturation curves | Profilin was diluted to 2 muM in increasing concentrations of urea (0 to 8 M) in 20 mM Tris-HCl pH 8.1, 1 mM EDTA, 1 mM DTT. The samples were incubated for 15 min. at room temperature and the intrinsic fluorescence change during a wavelength scan between 300 and 400 nm was measured in a Hitachi F4500 spectrophotometer with the excitation wavelength set at 295 nm. We recorded a shift of the emission peak from 332 nm to 352 nm upon denaturation with urea. For each sample we plotted the ratio F(352 nm)/F(332 nm) versus the concentration of urea in that sample (see Figure ) . Polyproline binding | A (GP5)3 peptide, derived from VASP, was used to compare the affinities of the profilin I mutants on a BiacoreX (Pharmacia). The amino terminally biotinylated peptide was coupled to a streptavidin coated Biacore biosensor chip (Pharmacia). The experiments were carried out and analyzed as described in . Actin binding assays | The affinity of the profilin mutants for alpha-actin was determined using gelsolin capped filaments as described in . To determine the effect on non-steady state actin polymerization we pre-incubated 10 muM actin (5 % pyrene labeled) with or without 5 muM profilin for 15 minutes at room temperature prior to the addition of a final concentration of 2 mM MgCl2 and 100 mM KCl. The fluorescence change was recorded using a Hitachi F4500 spectrophotometer. PI(4,5)-P2-binding | Microfiltration was performed as described using 4 muM profilin and different concentrations of PI(4,5)-P2 (Sigma) as indicated in Figure . For gel filtration experiments, 10 muM profilin was pre-incubated with PI(4,5)-P2 micelles for 30 min on ice prior to loading on a Superdex75 gel filtration column (SMART, Pharmacia). The peak surface of free profilin was determined and used to calculate the percentage of bound and free profilin in each sample. The competition experiment between actin and PI(4,5)-P2 was performed with 8 muM Mg2+-ATP-G-alpha-actin (5% pyrene labeled), 4 muM profilin and 36 muM PI(4,5)-P2 in 5 mM Tris-HCl, 0.2 mM ATP, 0.2 mM dithiothreitol, pH 7 in the absence of Ca2+ and Mg2+ to avoid precipitation of PI(4,5)-P2. Profilin and PI(4,5)-P2-micelles were incubated for 10 minutes on ice prior to addition of actin and subsequent incubation for 10 minutes at room temperature. Polymerization was started by adding KCl to a final concentration of 50 mM. Abbreviations : Circular dichroism : CD; enabled : Ena; phosphatidylinositol 4,5-bisphosphate : PI(4,5)-P2; phospholipase Cgamma1 : PLCgamma1; vasodilator stimulated phosphoprotein : VASP; reasonance units : RU. Authors' contributions : A.L. participated in design of the study, carried out the mutagenesis, the stability and CD experiments and the actin and PI(4,5)P2 binding studies and drafted the manuscript. V.J. purified the proteins and carried out the Biacore and microfiltration experiments. D.D. helped with the mutagenesis. J.V. participated in the design of the study. C.A. conceived the study, participated in the coordination and in the design of the study. Backmatter: PMID- 12069692 TI - Gene expression profile of HIV-1 Tat expressing cells: a close interplay between proliferative and differentiation signals AB - Abstract | Background | Expression profiling holds great promise for rapid host genome functional analysis. It is plausible that host expression profiling in an infection could serve as a universal phenotype in virally infected cells. Here, we describe the effect of one of the most critical viral activators, Tat, in HIV-1 infected and Tat expressing cells. We utilized microarray analysis from uninfected, latently HIV-1 infected cells, as well as cells that express Tat, to decipher some of the cellular changes associated with this viral activator. Results | Utilizing uninfected, HIV-1 latently infected cells, and Tat expressing cells, we observed that most of the cellular host genes in Tat expressing cells were down-regulated. The down-regulation in Tat expressing cells is most apparent on cellular receptors that have intrinsic receptor tyrosine kinase (RTK) activity and signal transduction members that mediate RTK function, including Ras-Raf-MEK pathway. Co-activators of transcription, such as p300/CBP and SRC-1, which mediate gene expression related to hormone receptor genes, were also found to be down-regulated. Down-regulation of receptors may allow latent HIV-1 infected cells to either hide from the immune system or avoid extracellular differentiation signals. Some of the genes that were up-regulated included co-receptors for HIV-1 entry, translation machinery, and cell cycle regulatory proteins. Conclusions | We have demonstrated, through a microarray approach, that HIV-1 Tat is able to regulate many cellular genes that are involved in cell signaling, translation and ultimately control the host proliferative and differentiation signals. Keywords: Background : Whole-genome expression profiling exemplified by the development of DNA microarrays represents a major advance in genome-wide functional analysis . In a single assay, the transcriptional response of each gene to a change in cellular state can be measured, whether it is a viral infection, host cell cycle changes, chemical treatment, or genetic perturbation. Specifically, systematic approaches for identifying the biological functions of cellular genes altered during these changes, such as HIV-1 infection, are needed to ensure rapid progress in defining significant host and viral genome sequences in directed experimentation and applications. Therefore, host cellular states can be inferred from the expression profiles, and the notion that the global transcriptional response constitutes a detailed molecular phenotype, such as class discovery, class prediction, drug target validation, and the classification of tumors by expression profiling has begun to receive considerable attention . Since its discovery, much of the mainstream human immunodeficiency virus type 1 (HIV-1) Tat research has focused on its ability to activate the HIV-1 LTR. However, to date, besides the transactivation activity on the HIV-1 promoter, few other effects exerted by HIV-1 Tat on cellular and viral genes has also been observed. The Tat protein has been shown to transcriptionally repress host cellular genes and be involved in the immunosuppression associated with viral infection. For instance, HIV-1 infection is able to down-regulate major histocompatibility complex type I (MHC-I) by various different viral proteins, including Tat which represses the transcription of MHC-I, Vpu which retains nascent MHC-I chains in the endoplasmic reticulum, and Nef which can mediate selective internalization of MHC-I molecules from the plasma membrane. MHC class I gene expression has also been shown to be reduced upon infection with the wild-type LAI virus or a Tat exon one recombinant virus . Tat has been shown to down-regulate mannose receptor, EDF-1, CD3-gamma, and TCR/CD3 surface receptor . Tat reduces mannose receptor levels and promoter activity in mature macrophages and dendritic cells by interfering with the host transcriptional machinery; resulting in decreased levels of surface mannose receptor needed for Ag (mannosylated albumin uptake) or pathogen capture (Pneumocystis carinii phagocytosis), and eventual delivery to MHC class II-containing intracellular compartments . EDF-1, a gene down-regulated when endothelial cells are induced to differentiate in vitro, was shown to be down-regulated by Tat at the transcriptional level, resulting in the inhibition of endothelial cell growth and in the transition from a nonpolar cobblestone phenotype to a polar fibroblast-like phenotype . When examining the in vivo effects of HIV-1 Tat protein in the Xenopus embryo, it was found that upon injection of synthetic Tat mRNA into zygotes, a marked delay in gastrulation occurred. This led to the altered specification of the anterior-posterior axis and partial loss of the anterior embryo structures. Mechanistically, HIV-1 Tat elicited a general suppression of gene expression, including that of Xbra and gsc, two early genes whose expression are required for proper gastrulation . In relation to the cell cycle, Tat has also been shown to bind to p53 and inhibit the transcription of p53 responsive elements, such as the p21/Waf1 gene promoter. Consequently, upon introduction of stress signals (e.g., gamma irradiation), HIV-1-infected cells lose their G1/S checkpoint, enter the S-phase inappropriately, and apoptose . Finally, the inhibition of Tat on translational machinery has also been noted. The potential translational inhibitory effects of the TAR RNA region is mediated by the activation of p68 (the interferon-induced 68-kilodalton protein kinase) kinase, which was down-regulated by Tat during productive HIV-1 infection . Although the mechanism of the host cellular down-regulation remains largely unknown, few reports have attempted to decipher the mechanism of the observed inhibition. For instance, the addition of Tat to PC12 cells up-regulated the expression of the inducible cAMP early repressor (ICER), a specific member of the cAMP-responsive element modulator transcription factor family, in a cAMP-dependent manner. In turn, ICER overexpression abrogated the transcriptional activity of the TH promoter, strongly suggesting ICER's involvement in Tat-mediated inhibition of gene expression . Aside from induction of ICER, Tat is capable of forming complex (es) with a component of TFIID, TAFII250 and Tip60 both of which contain histone acetyltransferase (HAT) activity. In these cases, Tat-TAFII250 and Tat-Tip60 do not affect the transcription from the HIV-1 LTR, but interfere with the transcription activity of cellular genes. It is postulated that different targets of HATs by Tat have different consequences. The interaction of Tat with p300/CBP and P/CAF stimulates its ability to transactivate LTR-dependent transcription, while Tat-TAFII250 or Tat-Tip60 interactions control the transcription of cellular genes. Here to better understand the host response to Tat, we have performed microarray experiments on HIV-1 infected cells expressing the Tat protein. To our surprise many host cellular genes were down-regulated when comparing HIV-1 infected latent cells to uninfected parental cells. Because most, if not all, latent infected cells available to date (e.g., ACH2, U1, J1.1, OM.10) have various expression levels of doubly spliced viral mRNAs, including Tat, Rev, Nef, Vpr, and other accessory proteins, we decided to perform the microarray in a system where Tat was constitutively expressed; asking whether Tat by itself, or in the absence of other accessory proteins, could still down-regulate host cellular genes. Consistent with latently infected cells, we found many cellular genes to be down-regulated in Tat expressing lymphocytes. The down-regulation is most apparent on cellular receptors that have intrinsic receptor tyrosine kinase (RTK) activity and signal transduction members that mediate RTK function; including the Ras-Raf-MEK pathway, and co-activators such as p300/CBP and SRC-1, which mediate gene expression related to hormone receptor genes. Interestingly, we also observed up-regulation of S-phase genes, as well as ribosomal genes involved in translation. Functionally, down-regulation of receptors may allow latent HIV-1 infected cells to either hide from the immune system or avoid extracellular differentiation signals normally regulated by receptors. Up-regulation of S-phase and translation genes may allow speeding of cells through the S-phase and subsequent accumulation at the G2 phase, where most of the cellular and viral translation may take place. Therefore, the presence of Tat may not only control activated transcription on HIV-1 LTR, but also aid in the subsequent translation of viral mRNA in the cytoplasm. Results and discussion : Host expression profiling in a sufficiently large and diverse set of profiles could allow additional hypotheses to be drawn regarding the function of genes based on the regulatory characteristics of their own transcripts . Here, we describe the effect of one of the most critical viral activators, Tat, involved in HIV-1 infection and pathogenesis. The rationale for these experiments came from the fact that many AIDS-infected patients who are either at stage III (non-progressors) or under highly active antiretroviral therapy (HAART) treatment show some level of doubly spliced viral messages in their infected cells. One of these messages, Tat, has been well studied and characterized, both from a viral activator standpoint, its effect on few host cellular genes, and its effect as an extracellular cytokine. However, to date there are no reported Tat gene expression analyses that detect more than a few cellular genes. We performed our microarray analysis first with a cDNA blot of 588 genes, which is known to contain various receptors, cytokines, transcription factors, DNA replication genes, and other additional well characterized genes. Figure shows the results of a microarray experiment from uninfected (CEM) and latently HIV-1 infected (ACH2) cells. By definition, latently HIV-1 infected cells contain integrated HIV-1 sequences in the host genome. To our surprise, we detected many cellular genes that were down-regulated in ACH2 cells as compared to CEM uninfected cells. ACH2 cells, similar to many other latent HIV-1 infected cells including U1, OM10.1, 8E5, and J1-1, express multiple doubly spliced messages including Tat, Rev, Nef, and Vpr . Therefore, it would be difficult to determine which one of these viral open reading frames was in fact controlling the observed changes in host gene expression. Figure 1 | Gene expression analysis of uninfected and HIV-1 infected cells. Gene expression analysis of uninfected and HIV-1 infected cells. A) Both CEM (uninfected) and ACH2 (latently HIV-1 infected) cells were grown to mid-log phase of growth and processed for RNA isolation. Total RNA was labeled with 32P-ATP and hybridized to human cDNA filters (Clontech, 588 genes). Blots were hybridized overnight, washed the next day, and exposed to a PhosphorImager cassette. B) Same as in panel A, except all the 588 genes were plotted as fold change vs. gene index (individual genes). Examples of three genes such as prothymosin-alpha, C-myc, and p21/Waf1, is shown on the diagram. C) Northern blot analysis of prothymosin-alpha, C-myc, p21/Waf1 and ubiquitin using 10 mug of total RNA, separated on 0.8% formaldehyde gel, and probed with 40 mer anti-sense oligos against respective genes. Bottom of panel C, last insert shows RNA ethidium bromide stain from CEM and ACH2 cells. Nonetheless, when mapping all the 588 genes, we found that 139 genes were activated above 1 fold and 449 genes were expressed below 1 fold . This is in sharp contrast to latent HTLV-1 infected Tax expressing cells, where more than two-thirds of the same set of genes were activated and scored above one . Some of the genes from HIV-1 latent cells were further processed as control experiments using Northern blot analysis. As can be seen in Figure , and consistent with previously published reports, p21/Waf1 was down-regulated and C-myc and pro-thymosin-alpha were up-regulated in HIV-1 latent cells. Collectively, these experiments point toward host cellular changes in the presence of doubly spliced HIV-1 RNA; however they do not explain whether Tat or other viral genes are responsible for the observed cellular changes. Therefore, we focused our attention on HIV-1 Tat protein, since Tat could readily be detected in immunoprecipitations from 35S labeled latent ACH2, U1, OM10.1, 8E5, and J1-1 cells (20, data not shown). We utilized a well-characterized system of H9 and H9/Tat cell lines for our next set of microarray experiments and increased our repertoire of the known cDNA genes from 588 to 2400. This was accomplished by using glass slides which were printed with cDNAs of 500 bases or higher, and could be used in hybridization with two different sets of RNAs labeled with either Tyramide linked Cy-3 or Cy-5. Results of such an experiment is shown in Figure , where H9 cytoplasmic Poly A+ selected RNA was labeled with Cy-5 and the H9/Tat RNA with Cy-3 prior to hybridization. When all the 2400 genes were plotted, some 695 genes were shown to be up-regulated above one fold and 1705 genes were down-regulated below one fold (right hand graphs). This was consistent with the results obtained from the ACH2 microarray experiment, where more than 2/3 of the cellular genes were down-regulated by one or more of the doubly spliced genes. We then arbitrarily chose a cut-off of three fold change for our next set of analyses. This was mainly because many of our in house microarray experiments with HIV-1, HTLV-1, and HHV-8 infection has shown a reproducible correlation between protein and mRNA levels when gene expression levels were up- or down-regulated by more than three fold (data not shown). A collection of all the genes above and below three fold are shown in Tables , , and . Based on existing literature, we categorized all of these genes into known pathways. For instance, genes in Table belong to receptors, co-receptors, and co-activators, genes in Table are all the translation related factors, and those in Table indicate genes that are involved in cytoskeleton, signal transduction, cell cycle, DNA repair, transcription, and chromatin remodeling processes. All genes have a number ratio of Cy3 to Cy5 (C3/C5) indicating a ratio of mRNA from H9/Tat over H9 cells. A brief name description and gene ID accession number is given to the right hand side of each ratio. All genes are divided into up (3 fold and higher) and down (3 fold and lower) regulated in Tat expressing cells. Below is a brief description of genes that we, along with the existing literature, were able to correlate with proliferative and/or differentiation signals. Figure 2 | Gene expression analysis from Tat expressing cells. Gene expression analysis from Tat expressing cells. Both H9 and H9/Tat cells were grown to mid-log phase of growth, processed for RNA preparation, and labeled with Tyramide linked Cy-5 (H9) or Cy-3 (H9/TAT). Labeled RNAs were hybridized simultaneously to a glass slide containing 2400 known cDNA genes (NEN Inc.). All genes were plotted similar to Figure and genes above & below 1 fold change were plotted (on the right hand side) to show activation and suppression of all genes. Table 1 | Receptors Table 2 | Translation Factors Table 3 | Receptor family members | It has long been known that infection by HIV-1 commonly leads to the down-regulation and the disappearance of CD4 receptors from the plasma membrane, a phenomenon referred to as receptor down-modulation. This, in turn, renders cells refractory to subsequent infection by the same or other viruses that use the CD4 receptor for entry; thus creating a state of super-infection immunity. Results in Table indicate that although few receptor genes were up-regulated, most of the cellular receptors in general, were down-regulated in the presence of the Tat protein. Most of these receptors or membranous proteins were initially discovered from immune or neuronal cells, hence they were given names related to the immune or nervous system. For instance, mRNA for the neuropeptide Y-like receptor (Acc# X71635), which was up-regulated in Tat expressing cells, was initially discovered as a G-protein coupled neuropeptide Y receptor, and later found to be homologous to the co-receptor CCR5 needed for HIV-1 infection of monocyte/macrophage cells. Therefore, most of the receptors listed in Table may in fact be expressed in various tissues and have multiple functions. Consistent with our microarray results on CCR5 up-regulation, experiments performed in peripheral blood mononuclear cells (PBMCs) with soluble Tat has shown selective entry and replication of CCR5 virus into cells . Up-regulation of HIV-1 coreceptor by Tat has also been reported, where a synthetic Tat protein that was immobilized on a solid substrate, up-regulated the surface expression of the chemokine receptors in purified populations of primary resting CD4+ T cells. Also, a similar result was seen from Tat protein actively released by HIV-1 infected cells, implying a potentially important role for extracellular Tat in rendering the bystander CD4+ T cells more susceptible to infection . We therefore tested whether H9/Tat cells, which showed an increase in CCR5 expression, could in fact allow better entry and infection of the CCR5 (R5) virus into cells. Figure shows the result of such an experiment, where H9/Tat cells allowed a better replication profile of the R5 than the CXCR4 (X4) virus. The increase in viral titer peaked after some 18 days of infection with the R5 virus, further implying that the CCR5 co-receptor allowed a better selection of R5 virus in Tat expressing cells. Figure 3 | Functional and physical confirmation of few genes from Tat expressing cells. Functional and physical confirmation of few genes from Tat expressing cells. A) Infection of mono- and T-tropic viruses into Tat expressing cells. Both HXB-2 and BaL strains of HIV-1 were infected into H9 and H9/TAT cells. Supernatants were collected every 3 days and further processed for p24 gag ELISA assays. B) Western blot analysis from H9 and H9/TAT expressing cells using co-activators (SRC-1), DNA damage (DNA-PK), activator (p300), and signal transduction (Ras, RAF, and MAPK) antibodies. TBP stands for TATA binding protein, which served as positive control in western blots. C) Western blot analysis from CEM (uninfected T-cell), ACH2 (infected T-cell), U937 (uninfected promonocytic), U1 (infected promonocytic), and PBMCs treated with purified Tat wild type or K41A mutant (100 ng/ml) proteins. Fifty microgram of whole cells lysates were processed for western blots with anti-DNA-PK, p300, RAF, and TBP antibodies. Another example of co-receptors with multiple functions is the leukotriene family member B4, which was down-regulated in Tat expressing cells (Acc# D89078, Table ). The cysteinyl leukotrienes (CysLT), LTC, LTD, and LTE, were first shown to be essential mediators in asthma . However, when the mouse leukotriene B4 receptor (m-BLTR) gene, was cloned it was shown to have significant sequence homology with chemokine receptors (CCR5 and CXCR4), co-receptors for many different HIV-1 clades . Along the same lines, when cells were infected with 10 primary clinical isolates of HIV-1, leukotriene B4 receptor was primarily utilized for efficient entry into cells which were mainly of the syncytium-inducing phenotype . Therefore, up-regulation of neuropeptide Y-like receptor and down-regulation of leukotriene B4 receptor in Tat expressing cells indicates a selective advantage of one class of virus (CCR5) over another (CXCR4). Other examples of consistency between our microarray results on receptors and the HIV-1 Tat literature, include the down-regulation of gene expression in uPAR (Acc# X74039), IP3 (Acc# D26070, D26351), Glu R flop (Acc# U10302), PPAR (Acc# L07592), alpha-2 macroglobulin receptor protein (Acc# M63959), and receptor tyrosine kinase (Acc# L36645, U66406) genes. The transmembranous urokinase-type plasminogen activator receptor (uPAR; CD87) focuses the formation of active plasmin at the cell surface, thus enhancing directional extracellular proteolysis. Interestingly, the promoter activity of the CD87 gene was shown to decline after infection , implying that post integration of HIV-1 may in fact down-regulate CD87 gene expression. Similarly, inositol 1,4,5-trisphosphate receptors (IP3R) are intracellular calcium release channels involved in diverse signaling pathways and are required for the activation of T lymphocytes . Tat (also implicated as a neurotoxin) has been shown to release calcium from inositol 1,4, 5-trisphosphate (IP3) receptor-regulated stores in neurons and astrocytes causing premature apoptosis . Down-regulation of IP3 may therefore contribute to viral latency and maintenance of an anti-apoptotic state in cells. HIV-1 infection can cause extensive neuronal loss and clinically, a severe dementia. The cause of the neurotoxicity remains unclear as neurons are not infected, but the disturbance of glutamate-linked calcium entry has been implicated. It has been shown that HIV-infected brain has a decrease of mRNA and protein of the GluR-A flop subtype of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA) glutamate receptor in cerebellar Purkinje cells. The observed disturbance of AMPA receptors may contribute to the neurotoxic process in other vulnerable brain regions and clinically to the development of dementia . Interestingly, in a mouse model AMPA receptors in the cortex, striatum, hippocampus, and cerebellum declined by 29 --50% as early as 8 weeks post-retroviral inoculation. Thus, the reduction in AMPA receptor density may contribute to the development of the cognitive abnormalities associated with HIV-1 infection . Finally, patients with AIDS who are receiving therapy with HIV-1 protease inhibitors have been reported to be afflicted with a syndrome characterized by lipodystrophy (fat redistribution favoring the accumulation of abdominal and cervical adipose tissue), hyperlipidemia, and insulin resistance. Potential mechanisms for altered adipocyte function include, direct binding to PPARgamma or inhibition of transcription of PPARgamma promoter . The lipodystrophy syndrome may be a result of the inhibition of 2 proteins involved in lipid metabolism that have significant homology to the catalytic site of HIV proteases; namely cytoplasmic retinoic acid binding protein type 1 and low density lipoprotein-receptor-related protein . An additional mechanism of PPAR down-regulation may be related to Tat expression in latent cells. Translation associated factors | Viruses have evolved a remarkable variety of strategies to modulate the host cell translation apparatus with the aim of optimizing viral mRNA translation and replication. For instance, viruses including Herpes simplex virus type 1 (HSV-1) have been known to induce severe alterations of the host translational apparatus, including the up-regulation of ribosomal proteins and the progressive association of several nonribosomal proteins, such as VP19C, VP26, and the poly(A)-binding protein 1 (PAB1P) to ribosomes . In the case of HIV-1, approximately one infectious HIV-1 genome in an infected cell could be transcribed and translated into 50,000 to 100,000 physical particles . This poses an immense challenge for the virus to be able to transcribe, splice, transport, and translate its RNA into fully packaged virions in a timely fashion. Therefore, it would be advantageous for the virus to set the stage for each successive step necessary for viral progeny formation. One such event is Tat's ability to control genes that aid in translational machinery. As seen in Table , many of the critical components of a functional ribosome, including large subunits L 3, 6, 26, 31, 38, and 41, as well as S 6, 12, 20, and 24, and many of the translation initiation factors are up-regulated by Tat. This would imply that Tat up-regulates many ribosomal genes that may be necessary to produce functional ribosomes needed for viral mRNA translation. Therefore, interfering with translation could provide a new strategy for anti-HIV treatment. Along these lines, when the aminogylcosides (kanamycin, hygromycin B, paromycin and neomycin) due to their ability to inhibit protein synthesis by affecting ribosomal fidelity, or puromycin because of its competing ability with tRNAs for binding on the large ribosomal subunit, or cycloheximide which inhibit the large ribosomal subunit by preventing ribosomal movement along the mRNA, were used in active HIV-1 infection, it was found that both cycloheximide and puromycin produced the greatest decrease in HIV-1 inhibition, presumably by inhibiting the large subunit of the ribosome . Translation of HIV-1 RNAs pose a challenge since they all contain a TAR sequence at their 5' end. The Tat-responsive region (TAR) of HIV-1 exhibits a trans-inhibitory effect on translation by activating the interferon-induced 68-kilodalton protein kinase. Productive infection by HIV-1 has been shown to result in a significant decrease in the amount of cellular p68 kinase. The steady-state amount of p68 kinase was found to be reduced in cells stably expressing Tat. Thus, the potential translational inhibitory effects of the TAR RNA region, mediated by activation of p68 kinase, may be down-regulated by Tat during activation of the latent virus . Along these lines, a Tat peptide antagonist, which bound specifically to TAR RNA and competed with Tat for binding, reduced Tat-dependent translation . Finally, upregulation of translation genes in Tat expressing cells is specially intriguing in light of the recent discovery of internal ribosome entry sites (IRESs) in HIV-1 gag ORF . IRESs are thought to promote initiation of translation by directly binding to ribosomes, in a manner independent of the mRNA cap or of scanning through upstream sequences. Since, the TAR is located at the 5' end of all HIV-1 RNA transcripts and the presence of secondary structure at or near the 5' end of RNAs reduces the accessibility of the 5' cap to eIF4F, it is thought that this feature of HIV-1 mRNAs can inhibit their cap-dependent translation . Therefore, a possible function of the HIV-1 gag IRES might be to serve as a mechanism to bypass the structural barriers to cap-dependent translation by recruiting ribosomes easily and directly to the gag ORFs. IRES entirely contained within a translated ORF has been shown in the MMLV gag , and host mRNA encoding p110PITSLRE and p58PITSLRE. Along these lines, cap-dependent translation may be cell cycle regulated, especially when cells are arrested at the G2 phase of the cell cycle, where the cap-dependent translation of most cellular host cell mRNAs is inhibited . Modulation of signal transduction pathway | Results in Table indicate that many seemingly different pathways are being regulated by Tat. However, the signal transduction pathway, MAPK, has been shown to control and be upstream of DNA-replication, transcription, and cell cycle pathways . The mitogen-activated protein kinase (MAPK) pathway, consisting of the MAP kinase kinases (MKKs) 1 and 2, and extracellular signal-regulated kinases (ERKs) 1 and 2, which have been implicated in diverse cellular processes including proliferation, transformation, and cell differentiation . The MAP kinase (MAPK) pathway has emerged as a crucial route between membrane-bound Ras and the nucleus. This MAPK pathway encompasses a cascade of phosphorylation events involving three key kinases, namely Raf, MEK (MAP kinase kinase) and ERK (MAP kinase). The MAPK pathway controls ERKs 1 and 2, c-Jun N-terminal kinase (JNK), and p38. These signaling pathways in turn, activate a variety of transcription factors including NF-kappaB (p50/p65), AP-1 (c-Fos/c-Jun), and CREB phosphorylation, which in turn coordinate the induction of many genes encoding inflammatory mediators. Cytokine receptors such as IL-3, GM-CSF, and the interferons transmit their regulatory signals primarily by the receptor-associated Jak family of tyrosine kinases, and activate STAT transcription factors. Activated STAT5 proteins are detected in reduced levels in lymphocytes recovered from HIV-infected patients and immunocompromised mice. Both of these types of receptor signaling pathways have recently been shown to interact with serine/threonine kinases such as MAP kinases. A common intermediate pathway initiating from receptors to the nucleus is the Ras/Raf/MEK/ERK (MAPK) cascade, which can result in the phosphorylation and activation of additional downstream kinases and transcription factors such as p90Rsk, CREB, Elk, and Egr-1 . Therefore, it is intriguing that Tat expressing cells show down-regulation of MAPK components (Table , Figure and ), essential mediators between receptors and nuclear transcription factors. This would imply that latently infected cells that express Tat (doubly spliced RNA) and not the whole virus (all three classes of the RNA), can control signal transduction related to membrane and transcriptional signaling . Interestingly, Tat, through the RGD motif, which controls integrin-based cell signaling, has been reported to mediate the activity of phosphotyrosine phosphatase(s). This in turn which would lead to a decrease in the levels of phosphotyrosine-containing proteins such as ERK-2/p42MAPK kinases . Cysteine-rich and basic Tat peptides have been shown to inhibit VEGF-induced ERK activation and mitogenesis. These peptides also inhibited proliferation, angiogenesis, and ERK activation induced by basic fibroblast growth factor with similar potency and efficacy . Consistent with this model, it has been shown that treatment of neural cells with culture supernatants from HAART-treated subjects, which presumably contain extracellular Tat, resulted in down-regulation of the JNK, AKT, and ERK kinases . Finally, activation of MAPKs has been shown to activate the singly spliced and unspliced (genomic) latent HIV-1 virus. For instance, the signal transduction pathways that regulate the switch from latent to productive infection have been linked to MAPK. The induction of latent HIV-1 expression has been shown to be inhibited by PD98059 and U0126, specific inhibitors of MAPK activation. The MAPK acts by stimulating AP-1 and a subsequent physical and functional interaction of AP-1 with NF-kappaB, resulting in a complex that synergistically transactivates the HIV-1 . At the level of infection and entry, the activation of MAPK through the Ras/Raf/MEK (MAPK kinase) signaling pathway enhances the infectivity of HIV-1 virions. Virus infectivity can be enhanced by treatment of cells with MAPK stimulators, such as serum and phorbol myristate acetate, as well as by coexpression of constitutively activated Ras, Raf, or MEK in the absence of extracellular stimulation . Also, following infection, efficient disengagement of the reverse transcription complex from the cell membrane and subsequent nuclear translocation, requires phosphorylation of the reverse transcription complex components by ERK/MAPK; demonstrating a critical regulation of an early step in HIV-1 infection by the host cell MAPK signal transduction pathway . Therefore, Tat down-regulation of the MAPK pathway in latent cells implies that much of the host signal transductions connected to activation are down-regulated, and at the same time, these cells may be refractory to subsequent infection by other viruses. Thymosin family members, and cell cycle | Prothymosin alpha (ProTalpha) belongs to the alpha-Thymosin family which comprises different polypeptides widely distributed within animal tissues. Although its role has remained controversial, it is involved in the increase of immediate early genes such as c-myc , which is upstream of cyclin D synthesis and necessary for cell division . In humans, ProTalpha is coded by a gene family of six members. One of them contains introns, exons and classic regulatory signals, while the remaining five are intronless genes located on chromosome 2 . There are two mRNA transcripts, which arise in a ratio of 9:1 (shorter/longer form), where only the long transcript is regulated by extracellular signals. It has been demonstrated that malignant tissues with accelerated cell cycle show higher levels of ProTalpha expression than normal or surrounding healthy tissues . ProTalpha was shown as a marker for breast cancer , hepatocarcinoma , and plasma levels of its derivative Talpha1 been proposed as a marker for the prognosis of lung cancer . In ligand blotting assays, ProTalpha bound only to chromatin pools and nuclear fractions where histone H1 was present . The analysis of the interaction of ProTalpha with H1-containing chromatin suggests a putative role for ProTalpha in the fine-tuning of the stoichiometry and/or mode of interaction of H1 with chromatin . Interestingly, HL-60 cells overexpressing ProTalpha show an enhancement of accessibility of micrococcal nuclease to chromatin, implying relaxed chromatin structure for enhanced cell cycle gene expression . A broad study using several mononuclear and fibroblastic cell lines has shown that ProTalpha mRNA accumulation is cell cycle phase-dependent. In the U937 monocytic cell line, ProTalpha mRNA peaked at the end of S/G2 phase and fell towards the entry into the new G1 phase. More prominent mRNA regulation was found in the fibroblastic cell lines CV1 and NIH3T3, with peak mRNA levels at the end of S-phase. In all cases the expression pattern coincided with that of cyclin B and Cdc2/cyclin B activation . It is interesting to note that Cdc2 (Acc# X05360), Cdc10 homolog (Acc# S72008), and Cdc37 (Acc# U43077) were all up-regulated in Tat expressing cells. Cdc2, a catalytic subunit of cyclin-dependent kinases, is required for both the G1-to-S and G2-to-M transitions. In the fission yeast Schizosaccharomyces pombe, the execution of Start requires the activity of the Cdc2 protein kinase and the Cdc10/Sct1 transcription complex. The loss of any of these genes leads to G1 arrest . Cdc37 encodes a 50-kDa protein that targets intrinsically unstable oncoprotein kinases including Cdk4, Raf-1, and v-src to the molecular chaperone Hsp90, an interaction that is thought to be important for the establishment of signaling pathways. Cdc37 expression may not only be required to support proliferation in cells that are developmentally programmed to proliferate, but may also be required in cells that are inappropriately induced to initiate proliferation by oncogenes. For instance, MMTV-Cdc37 transgenic mice develop mammary gland tumors at a rate comparable to that observed previously in MMTV-cyclin D1 mice, indicating that Cdc37 can function as an oncogene in mice and suggests that the establishment of protein kinase pathways mediated by Cdc37-Hsp90 can be a rate-limiting event in transformation . Also, analysis of proteins that co-immunoprecipitated with Cdk6 and Cdk4 has shown complexes containing both Hsp90 and Cdc37 . Cdc37 also promotes the production of Cak1. Cak1 in yeast is the human homolog of CAK trimeric enzyme containing CDK7, cyclin H, and MAT1. Both human and yeast Caks function as RNA polymerase II CTD kinase, Cdk activating kinase, and DNA damage/repair enzymes. Cdc37, like its higher eukaryotic homologs, promotes the physical integrity of multiple protein kinases, perhaps by virtue of a cotranslational role in protein folding . Finally, Hsp90/Cdc37 has recently been shown in the stabilization/folding of Cdk9 as well as the assembly of an active Cdk9/cyclin T1 complex responsible for P-TEFb-mediated Tat transactivation . Transcription and chromatin remodeling factors | A highly ordered chromatin structure presents a physical obstacle for gene transcription; presumably by limiting the access of transcription factors and RNA polymerase II core machinery to target DNA . In concert with the observation that corepressors are associated with HDAC activities , it appears that the transcriptional outcome of nuclear receptors is determined by the balance of histone acetylation and deacetylation activities, and that ligands serve as a switch to recruit HATs with the concomitant dismissal of HDACs. Signal transduction pathways add another layer of regulation to the functions of CBP/p300. In the case of the POU homeodomain factor Pit-1, transcriptional activity is potentiated by MAPK pathways . Therefore, down-regulation of MAPK pathway members in Tat expressing cells, as seen in Table , is consistent with decreased phosphorylation of DNA binding factors such as Pit-1, and overall lower DNA binding activity. Here, we describe the effect of coactivator proteins SRC-1 (Acc# AJ000882, U90661, Table ) and p300 (Acc# U01877, Table ), and their relation to differentiation genes such as retinoic acid receptor (RAR/PML, Acc#: X06614, Table ), and Leptin receptor variant (Acc#: U66496, Table ); all of which are down-regulated in Tat expressing cells . Figure 4 | Synthesis of IL-8 in Tat expressing cells. Synthesis of IL-8 in Tat expressing cells. Hela cells (pCEP4, and eTat) were either unblocked (unt), or blocked with hydroxyurea (Hu) (2 mM) for 14 h, released, washed twice with phosphate-buffered saline (PBS) and subsequent addition of complete medium . Supernatants were collected at 9 hrs after release for ELISA. All remaining suspension cells were treated with 1% serum for 48 hrs prior to addition of Hu. PHA-activated PBMCs were kept in culture for 2 days prior to addition of Tat protein. Approximately 5 x 106 PBMCs were used for treatment with either wild type or K41A Tat mutant (100 ng/ml) proteins. After an initial incubation for one hr with Tat proteins, cells were washed and cultured in complete media for 24 hrs, prior to IL-8 ELISA. Figure 5 | Predictive model for control of gene expression and signal transduction by constitutive Tat expressing cells. Predictive model for control of gene expression and signal transduction by constitutive Tat expressing cells. Down-regulation of SWI/SNF components such as BAF 170 and 60 along with coactivators CBP/p300 and SRC-1 may down-regulate a subset of cellular genes that depend on chromatin remodeling and/or co-activator function for their gene expression. Such genes depend on the presence of ligand receptors that require either both SRC-1 and p300 or individual co-activator for their activity. Over the past three decades a great deal of evidence has accumulated in favor of the hypothesis that steroid receptor hormones act via regulation of gene expression. The action is mediated by specific nuclear receptor proteins, which belong to a superfamily of ligand-modulated transcription factors that regulate homeostasis, reproduction, development, and differentiation . This family includes receptors for steroid hormones, thyroid hormones, hormonal forms of vitamin A and D, peroxisomal activators, and ecdysone . Nuclear hormone receptors are ligand-dependent transcription factors that regulate genes critical to such biological processes as development, reproduction, and homeostasis. Interestingly, these receptors can function as molecular switches, alternating between states of transcriptional repression and activation, depending on the absence or presence of a cognate hormone, respectively. In the absence of cognate hormone, several nuclear receptors actively repress transcription of target genes via interactions with the nuclear receptor corepressors SMRT and NCoR. Upon binding of the hormone, these corepressors dissociate from the DNA-bound receptor, which subsequently recruits a nuclear receptor coactivator (NCoA) complex. Prominent among these coactivators is the SRC (steroid receptor coactivator) family, which consists of SRC-1, TIF2/GRIP1, and RAC3/ACTR/pCIP/AIB-1. These cofactors interact with nuclear receptors in a ligand-dependent manner and enhance transcriptional activation via histone acetylation/methylation and recruitment of additional cofactors such as CBP/p300 . CBP/p300 has been implicated in the functions of a large number of regulated transcription factors based primarily on physical interaction and the ability to potentiate transcription when overexpressed . In the case of nuclear receptors, the interaction with CBP/p300 is ligand-dependent and relies on the conserved nuclear receptor functional domain, AF-2 (activation function 2). In vivo studies have supported the conclusion that CBP/p300 are components of the hormonal-regulation of transcription in fibroblasts isolated from a p300-/- mouse; and loss of the p300 gene severely affects retinoic acid (RA)-dependent transcription . In a separate study using hammerhead ribozymes that specifically cleave CBP or p300 mRNA, Kawasaki et al reported that reduced cellular CBP or p300 levels resulted in compromised expression of endogenous RA-inducible genes such as p21/Waf1 and p27 cdk inhibitors. Along this line, Tat expressing cells have lower levels of p21/Waf1 presumably due to inactivation of p53 and a lack of p300/RA- induced gene expression. Consistent with this interpretation, CBP and p300 harbor transcriptional activation of ligand-induced RA or ER function on a chromatinized template . The NcoA family members constitute SRC-1/NcoA-1 , TIF2/GRIP1/NcoA-2, and pCIP/ACTR/AIB1 proteins, which interact with liganded RA receptor (RAR), and CBP/p300. Overexpression of these NCoA factors enhances ligand-induced transactivation of several nuclear receptors . A weak intrinsic HAT activity has been reported in SRC-1/NCoA-1 and pCIP/ACTR/AIB1, suggesting that chromatin remodeling may also be a function of these NCoA factors ; although they do not appear to contain regions homologous to the HAT domains of CBP/p300 or p/CAF. Structure-function analysis of the NCoAs have revealed multiple copies of a signature motif, LXXLL, with conserved spacing that is required for interaction with nuclear receptors and CBP/p300 . Intriguingly, different LXXLL motifs are required for PPARgamma (Peroxisome Proliferator activated receptor gamma, a gene down-regulated in Tat expressing cells; Acc# L07592, Table ) function in response to different classes of ligands, suggesting distinct configuration of assembled complexes. Taken together, through the use of microarray technology, we have described one of the first observations about how Tat is able to control various host cellular machineries. Although our data is consistent with most of the cited literature on the effects of Tat in infected host and uninfected bystander cells, we caution that the transcriptional profiling in chronically infected cells such as ACH2 or H9/Tat cells may not necessarily be representative of the pattern of expression observed in most cells infected by other group M, N, or O HIV-1 isolates. We recently extended our observations by utilizing other HIV-1 infected cells which normally express Tat (U1), and addition of exogenous purified Tat to uninfected PBMCs. Preliminary results using western blots supports the idea that genes which were altered in H9/Tat system also showed a similar level of change in few of the tested genes . This notion of consistency was further confirmed using the IL-8 activation by Tat. Interleukin-8 (IL-8) belongs to the CXC chemokine family and is secreted by several different cell types, including monocytes, neutrophils, endothelial cells, fibroblasts, and T lymphocytes. IL-8 production (induced by several stimuli, including IL-1, TNF-, and phorbol myristate acetate) is primarily regulated at the transcriptional level. IL-8 is a potent chemotactic factor for granulocytes and T lymphocytes, and is found in HIV-infected individuals. The CXC chemokine IL-8 does not bind to CCR5. It has previously been shown that IL-8 mRNA induction was seen less then 1 h after Tat (72aa) stimulation, and levels remained elevated for up to 24 h, leading to IL-8 protein production . Along these lines, we have previously shown that the IL-8 gene is expressed in a cell cycle-dependent manner in cells that express the Tat protein, and the induction is during the S phase of the cell cycle and regulated by stable NF-kB binding to the IL-8 promoter . When looking for IL-8 at the G1/S border, we found that all Tat containing cells, including PBMCs that were treated with exogenous Tat showed an up-regulation of IL-8 in the supernatant , further implying that results obtained from the H9/Tat system may infact be of general physiological relevance in vivo. Figure 6 | Proposed model for changes in signal transduction. Proposed model for changes in signal transduction. A) Down-regulation of receptor tyrosine kinases (RTK) by Tat which modulates the phosphorylation and transcription of downstream effectors such as Ras, Raf, MEK, MAPK, and control transcription factor phosphorylation. B) Role of Tat in the increase of genes necessary for proliferation, such as Cdc2, Cdc37, and Prothymosin alpha, and down-regulation of differentiation genes, such as receptors, co-receptors, and signal transduction genes. Finally, throughout the current study we came across some technical findings that were critical in the confirmation of most of our results. For instance, few genes did not correlate in their activation or suppression levels when comparing fold changes between microarrays and protein levels using western blot analysis. We suspect this is because many genes that are transcribed may not necessarily be translated, due to their cell cycle stage, 5' stem and loop RNA structures, varying half-lives of proteins and mRNAs, and a host of other unknown variables. Also, specific changes that occur in a cell may not be required in redundant pathways that score for a specific function. This is commonly seen in the differences between HIV-1 infected or Tat expressing in vitro cell lines and AIDS patients PBMC samples. Therefore, other microarrays would have to be performed on purified infected PBMCs to confirm most of the changes observed in Tables , , and . Unfortunately, to date this particular issue is not feasibly addressable, since it is not possible to isolate a homogenous population of infected T- or Monocytic cells from AIDS patients. Also, confirmatory tests for protein expression would have to be done with both hydrophilic and hydrophobic extraction buffers. For instance, we have observed that PCNA protein, which is up-regulated in Tat expressing cells, extract best with hydrophobic buffers from the nucleus, presumably due to its binding to DNA replication machinery (data not shown). Future experiments will address issues related to differences between various HIV-1 Tat clades, host expression levels between T- and Monocytic cells, and its effect at various stages of the cell cycle. Conclusions : Expression profiling from HIV-1 or Tat expressing cells holds great promise for rapid functional analysis. Here, we have described the effect of Tat and its alterations with the host cellular gene expression. We observed that more than 2/3 of the cellular genes tested were down-regulated by Tat. These genes belong to receptor, co-receptor, and co-activator pathways that are part of serine/threonine receptor tyrosine kinase, Ras/Raf/MEK/ERK (MAPK) cascade, which control proliferative and/or differentiation signals. We also observed a great deal of increase in the host cell translation apparatus with the possible aim of optimizing viral mRNA translation prior to viral maturation and release. Therefore, HIV-1 accessory doubly spliced messages such as Tat, may control the host gene expression in latently infected cells, and determine not only viral transcription, but also the fate of post-transcriptional events. Materials and method : Cell culture | ACH2 cells are HIV-1 infected CD4 lymphocytic cells, with an integrated wild-type single-copy chromatinized DNA. The CEM T cell (12D7) is the parental cell for ACH2 cells. ACH2 cell lines has a single copy of LAI strain proviral sequence. The TAR has a point mutation at (C37 -> T), which no longer responds (efficiently) to Tat. However, the cell line is fully capable of making infectious virus in presence of TNF, PHA, PMA, and a host of other stimuli. H9 and H9/Tat cells are both CD4+ Lymphocytic cells, where H9 cells carry a control integrated vector without the Tat open reading frame, and H9/Tat cells carry integrated Tat expression vector. Both cell lines were a generous gift of George Pavlakis (NCI, NIH). U1 is a monocytic clone harboring two copies of the viral genome from parental U973 cells. All cells were cultured at 37C up to 105 cells per ml in RPMI-1640 media, containing 10% Fetal Bovine Serum (FBS) treated with a mixture of 1% streptomycin and penicillin antibiotics, and 1% L-glutamine (Gibco/BRL). Phytohemagglutinin-activated PBMC were kept in culture for 2 days prior to addition of Tat protein. Isolation and treatment of PBMC were performed by following the guidelines of the Centers for Disease Control. Approximately 5 x 106 PBMC were used for treatment of wild type and K41A Tat mutant (100 ng/ml) proteins. After an initial incubation for one hr with Tat proteins, cells were washed and cultured in complete media for 24 hrs, prior to western blots. pCEP4, eTat cells were HeLa cells stably transfected with either a backbone control plasmid (pCEP4; Invitrogen) or a plasmid expressing Tat (1 --86) with a C-terminal epitope tag (eTat) . HeLa cell lines containing either the control or eTat plasmid were selected by single-cell dilution. Both cell types were selected and maintained under 200 mug of hygromycin per ml. Verification of Tat transcriptional activity was achieved by electroporation of reporter plasmids as previously described . Cell cycle analysis | Hela cells were blocked with hydroxyurea (Hu) (2 mM) for 14 h. Following the block, cells were released by being washed twice with phosphate-buffered saline (PBS) and by the addition of complete medium. All suspension cells were treated with 1% serum for 48 hrs prior to addition of Hu. Supernatants were collected and analyzed by an IL-8 ELISA according to the manufacturer's instructions (Biosource International). For controls, each sample, approximately 1 x 106 cells was processed for cell sorting. Cells were washed with PBS and fixed by addition of 500 mul of 70% ethanol. For fluorescence-activated cell sorting (FACS) analysis, cells were stained with a cocktail of propidium iodide (PI) buffer (PBS with Ca2+ and Mg2+, RNase A [10 mug/ml], NP-40 [0.1%], and PI [50 mug/ml]) followed by cell-sorting analysis. FACS data acquired were analyzed by ModFit LT software (Verity Software House, Inc.). Cell extract preparation and immunoblotting | All cells were cultured to mid-log phase of growth, washed with PBS without Ca2+ and Mg2+, and lysed in a buffer containing 50 mM Tris-HCl (pH 7.5), 120 mM NaCl, 5 mM EDTA, 50 mM NaF, 0.2 mM Na3VO4, 1 mM DTT, 0.5% NP-40 and protease inhibitors (Protease inhibitor cocktail tablets, Boehringer Mannheim, one tablet per 50 ml). The lysate was incubated on ice for 15 min, and microcentrifuged at 4C for 10 min. Total cellular protein was separated on 4 --20% Tris-glycine gels (Novex, Inc.) and transferred to a polvinylidene difluoride (PVDF) membranes (Immobilon-P transfer membranes; Millipore Corp.) overnight at 0.08 A. Following the transfer, blots were blocked with 5% non-fat dry milk in 50 ml of TNE 50 (100 mM Tris-Cl [pH 8.0], 50 mM NaCl, 1 mM EDTA) plus 0.1% NP-40. Membranes were probed with a 1:200 --1:1000 dilution of antibodies at 4C overnight, followed by three washes with TNE 50 plus 0.1% NP-40. All antibodies used in this study were purchased from Santa Cruz Biotechnology. The next day, blots were incubated with 10 ml of 125I-protein G (Amersham, 50 mul/10 ml solution) in TNE 50 plus 0.1% NP-40 for 2 hrs at 4C. Finally, blots were washed twice in TNE 50 plus 0.1% NP-40 and placed on a PhosphorImager cassette for further analysis. Total RNA purification | Cells were grown to mid-log phase of growth (5.0 x 106), pelleted, and washed twice with cold D-PBS without Ca2+/Mg2+. Total RNA was extracted on ice using Trizol Reagent (Life Technologies, Inc.). Purified RNA was then analyzed on a 1% agarose gel for quality and quantity prior to each experiment. Glass slide microarray | Gene expression analysis was performed using MicromaxTM: Human cDNA Microarray System I (cat# MPS101, NEN Life Science Products). On a glass microarray slide, 2400 know human genes were arrayed into 4 separate grids (A, B, C, D), containing 600 genes each (gene description and location on microarrays available at NEN website: ). All human genes were ~2200 bp cDNAs, and were characterized from 50+ human cDNA libraries (AlphaGene, Inc., Woburn, MA). In addition to the human genes, three plant control genes were spotted on each grid and were utilized to balance the Cyanine-3 (Cy-3) and Cyanine-5 (Cy-5) fluorescence signals. A total of 8 mug each of H9 (control sample) and H9/Tat (test sample) mRNAs were reverse transcribed into Biotin and Dinitrophenyl (DNP) labeled cDNA, respectively. After cDNA quality and quantities were analyzed, both cDNAs were then pooled and simultaneously hybridized overnight at 65C onto the glass microarray. The next day, the microarray slide was serially washed in 0.5x SSC (Sodium Citrate-Sodium Chloride) + 0.01% SDS (Sodium Dodecyl Sulfate), 0.06x SSC + 0.01% SDS, and 0.06x SSC. Next, the Tyramide Signal Amplification (TSATM) was then used to amplify the Cy-3 and Cy-5 signals using antibody-enzyme conjugates, alpha-DNP-Horseradish peroxidase (HRP) and alpha-Streptavidin-HRP with Tyramide linked Cy-3 and Cy-5. Screening and data analysis was performed by NEN. cDNA filter hybridization | Gene expression of CEM and ACH2 were performed using Atlas Human cDNA Expression Array (Clontech Laboratories Inc., Palo Alto, CA) according to the manufacturer's directions. One mug of poly A+ RNA each was DNase I treated, purified using a CHROMA SPIN-200 column, and reverse transcribed into 32P-labeled cDNA. The CHROMA SPIN-200 column was used to purify the 32P-labeled cDNA from unincorporated 32P-labeled dNTPs and small (<0.1 kb) cDNA fragments. Each sample was then hybridized to a human cDNA expression array overnight with continuous agitation at 68C. The next day, the array was washed three times with gentle agitation, first wash with 2x SSC + 1% SDS and the last two washes with 0.1x SSC + 0.5% SDS at 37C. Array was exposed to a PhosphorImager Cassette and analyzed using ImageQuant software. Northern blots | Total cellular RNA was extracted using the RNAzol reagent (Gibco/BRL). Total RNA (20 mug) was isolated from various cells and ran on a 1% formaldehyde-agarose gel overnight at 75 V, transferred onto a 0.2 mum nitrocellulose membrane (Millipore Inc.), UV cross-linked, and hybridized overnight at 42C with 32P-end-labeled 40 mer oligo probes including p21/Waf1, C-myc, Pro-thymosin, Actin, Tat, and Ubiquitin (Loftstrand, Gaithersburg, Md.). Next day, membranes were washed two times for 15 min each, with 10 ml of 0.2% SDS-2XSSC at 37C, exposed, and counted on PhosphorImager Cassette. Viral infection and ELISA assay | Both H9 and H9/Tat cells were infected in the presence of 10 ug of polybrene. For PBMC infections, PHA activated PBMCs were kept in culture for 2 days prior to each infection. Isolation and treatment of PBMCs were performed by following guidelines from the CDC (Isolation, culture, and identification of HIV, Procedural Guide, July 1991, Atlanta, GA). Approximately 2 x 10 6 of H9 or H9/Tat cells, and 5 x 10 6 PBMC cells were infected with either an HXB-2 (CXCR4, T-tropic), or BaL (CCR5, Macrophage-tropic) at 5 ng of p24 gag antigen/ HIV-1 strain. Both viral isolates were obtained from the NIH AIDS research and reference reagent program. After 8 hrs of infection, cells were washed and fresh media was added. Samples were collected every 3rd day and stored at -20 C for p24 gag ELISA. Media from HIV-1 infected cells were centrifuged to pellet the cells and supernatants were collected, and diluted to 1:100 to 1:1000 in RPMI 1640 prior to ELISA. The p24 gag antigen level was analyzed by HIVAGTM-1 Monoclonal antibody Kit (Abbott Laboratories, Diagnostics Division). Authors' Contributions : CF, and FS carried out the ACH2 and H9/Tat microarrays. LD, CE, IZ, CGL, and KW aided in westerns, northerns, p24 and ELISA assays. AM, KK, SB, AP, and FK aided in data interpretation, Bioinformatics, literature searches and writing the manuscript. Backmatter: PMID- 12052258 TI - Hospital competition, resource allocation and quality of care AB - Abstract | Background | A variety of approaches have been used to contain escalating hospital costs. One approach is intensifying price competition. The increase in price based competition, which changes the incentives hospitals face, coupled with the fact that consumers can more easily evaluate the quality of hotel services compared with the quality of clinical care, may lead hospitals to allocate more resources into hotel rather than clinical services. Methods | To test this hypothesis we studied hospitals in California in 1982 and 1989, comparing resource allocations prior to and following selective contracting, a period during which the focus of competition changed from quality to price. We estimated the relationship between clinical outcomes, measured as risk-adjusted-mortality rates, and resources. Results | In 1989, higher competition was associated with lower clinical expenditures levels compared with 1982. The trend was stronger for non-profit hospitals. Lower clinical resource use was associated with worse risk adjusted mortality outcomes. Conclusions | This study raises concerns that cost reductions may be associated with increased mortality. Keywords: Introduction : The last two decades brought about fundamental changes in the organization and delivery of medical services in the United States as payers seek to control the escalation in health care expenditures. Policies addressing these issues have been of two types. The first relies on containing costs through control of the prices paid to providers, beginning with the Prospective Payment System (PPS) for hospitals in 1983, Resource Based Relative Value Units (RBRVUs) payment for physicians in 1992 and the most recently implemented prospective payment for nursing homes. Such prospective payment systems provide the same incentives to cut costs to all providers, irrespective of the markets in which they are located and the competitiveness of their markets. The other relies on changing the focus of competition among health care providers, from quality based competition to price based competition . These policy changes were successful in bringing about a deceleration in hospital revenues and expenditures growth . Little is known, however, about what specific strategies hospitals adopted and the impact these strategies may have had on the quality of care patients receive. Previous studies found that hospitals increased efficiency in all clinical services following selective contracting in California. California hospitals also tended to specialize and differentiate themselves from similar hospitals in response to competitive pressures . A similar response, of increased specialization, was observed for a national sample of hospitals following implementation of PPS . In this paper we study another potential strategy that hospitals may adopt and which has not been addressed in the literature to-date. We investigate the hypothesis that hospitals in an increasingly price competitive environment, shift resources from activities related to clinical services, which are not easily observed and evaluated by patients, into hotel services which are easily observed. We study hospitals in California, comparing resource allocation during a regime dominated by quality competition and a regime dominated by price competition. We then examine the association between risk adjusted excess hospital mortality and resource use in clinical services, to investigate the potential impact on quality of medical care and health outcomes. Competition in California in the 1980s: a case study | The implementation of selective contracting in California in 1982 offers a unique natural experiment to study the response of hospitals to changes in the nature of competition. Unlike other health care markets, in which the change from quality to price based competition was gradual, driven by continuously increasing penetration of managed care, and often time confounded by other secular trends, the California legislation changed market conditions very rapidly for all hospitals in the state by permitting all health plans for the first time to contract with only a subset of hospitals. It thus allows a pre/post study design: hospitals resource allocation decisions during the quality competition regime (pre period) can be compared to decisions made during the price competition regime (post period). This natural experiment allows us to test the hypothesis that changes in the nature of competition are more likely to be associated with a shift of resources from clinical to hotel activities (and a concomitant deterioration in mortality outcomes) in more competitive hospital markets. As the level of hospital competition has not changed during the period (the Herfindahl-Hirschman Index (HHI) remained stable in all markets), this test is limited to the change in the nature of competition and is not confounded by the impact of changes in the level of competition on resource allocation decisions. During the same time period, California hospitals were also subject for the first time to price regulation, due to implementation of the Medicare PPS. While PPS also provided hospitals with incentives to lower their costs, it did so in a distinctively different manner than price competition. The PPS set the price per discharge hospitals were paid, thus creating incentives to lower costs, irrespective of market structure (7). The intensity of price based competition, on the other hand, is highly sensitive to the competitiveness of the hospital market. The analytical strategy of this paper is based on this distinction. Hospital competition, quality, resource allocation and health outcomes | Competition focused on prices, as is often the case in markets dominated by managed care, creates incentives to increase efficiency and possibly curtail resource use. With the exception of possible increases in administrative activities designed to contain costs in other areas (e.g. billing and utilization review) or to increase marketing efforts, such incentives to cut costs are likely to affect all aspects of hospital activities. Hospitals may also compete on quality, both quality of medical services and quality of hotel services and amenities. The importance of competition for quality is likely to be greater in markets in which hospitals compete for patients directly, as they do for all fee-for-service patients and for those enrolled in HMOs that offer a choice of hospitals within their market. Furthermore, to the extent that HMOs make their contracting decisions based on beneficiary hospital preferences, perceptions of quality are important competitive tools. Competition for quality , unlike competition for price , may lead to increased costs. Furthermore, it may affect clinical and hotel services differently. In markets where patients' choice of hospitals are increasingly important, hospitals are likely to compete more on quality attributes that patients observe and value. Given the difficulty that patients have in directly determining the quality of medical care they receive, and the relative ease with which they can evaluate the quality of hotel services (e.g. condition of the facility, quality of food) hospitals face incentives to shift resources from clinical activities to amenities. On the other hand, if patients rely on their physician's recommendations in choosing hospitals , and to the degree that physicians can assess clinical quality, albeit imperfectly, hospitals are faced with counter incentives, incentives that would promote resource use in clinical activities rather than hotel services. As a result, hospitals may face conflicting incentives: incentives to maintain or enhance the quality of hotel services on the one hand, and incentives to maintain activities that contribute to the quality of clinical care and health outcomes on the other. The actual choices that hospitals make about resource allocation depend on the relative strength of these opposing incentives. A model of changes in resource allocation | As the main hypothesis of interest is that the change in the nature of competition was associated with changes in hospital resource allocations, the model we hypothesize allows the marginal effects of market and hospital characteristics (Xt) on resource allocation (Yt), as measured by the coefficients in a regression model (betat), to vary over time: (1) Yt = alphat + betatXt + epsilont The models we estimated were difference models of the form (2) DeltaY = Deltaalpha + Deltabeta * X0 + betat * DeltaX + Deltaepsilon where Delta is the difference between year t and the base year, indicated by t = 0. From (2) it follows that betat, the vector of coefficients multiplying the change variables, measures the marginal effect of the variable in the end year, while Deltabeta, the vector of coefficients multiplying the level variables, measures the change in the marginal effect. The marginal relationship in year 0 is given by beta0 = betat - Deltabeta.. Methods : Sample | The initial sample included all 338 acute care hospitals in California that were in operation during both 1982 and 1989. Of those, 18 (5.3%) were excluded from the resource allocation analyses and 8 (2.4%) were excluded from the mortality analyses, because of incomplete data. Data sources | Financial, ownership and utilization data were obtained from the Hospital Annual Financial Disclosure Reports, filed annually by all California hospitals with the Office of Statewide Health Planning and Development (OSHPD). Risk adjusted mortality data were obtained from the Medicare Hospital Information Report published by the Health Care Financing Administration . Variable definitions | I. Resource allocation variables | Resource allocation was measured by expenditures per adjusted discharge. Adjusted discharges are a composite measure of input designed to account for both inpatient discharges and outpatient visits, using the methodology developed by the American Hospital Association. Expenditures per adjusted discharge were calculated separately for three categories: clinical, hotel and administrative services. Expenditures were aggregated by cost center, with each cost center assigned to one of the three services. The table in the lists all hospital cost centers and their assignment to hotel, clinical and administrative categories. The dependent variables in the resource allocation analyses were defined as the differences in expenditures per adjusted discharge, between 1989 and 1982, for each of the three categories. II. Quality variables | The dependent variables for the analyses of quality of clinical care were excess death rates from all causes and from 4 specific medical conditions that have relatively high death rates: acute myocardial infarction, congestive heart failure, pneumonia and stroke. We included in the analyses measures based on cause specific mortality in addition to overall mortality because prior studies have shown that these measures tend to be uncorrelated, and that hospitals performing well in one clinical area do not necessarily perform well in others. Measures based on overall mortality may therefore be biased towards zero, showing less variation compared with cause specific measures. Excess mortality was defined as the difference between the observed mortality rate for the hospital and a predicted, risk adjusted mortality rate. Observed and predicted mortality rates were obtained from the Medicare Hospital Reports . They are based on Medicare discharges and include all deaths within 30 days of admission, irrespective of the location of death. The risk adjustment methodology used by the Health Care Financing Administration, incorporates individual patients' age, gender, specific diagnoses and comorbidities, admission source, emergency or elective admission and the patient's risk group based on hospitalizations during the preceding 6 months . III. Independent variables | Competition was measured by the Herfindahl-Hirschman Index (HHI), defined as the sum of squared market shares of all hospitals competing in the same area. Hospital market areas and the HHI were calculated based on all payer zip code level patient flows, as described in Zwanziger et al. . To control for financial pressures hospitals may have been experiencing in addition to competition, we included variables measuring bad debt and charity as percent of total revenues and percent occupancy. To control for potential economies of scale the estimated models included total clinical standard units of measures reported in the California Financial Disclosure Reports. Ownership indicator variables included for-profit, not-for profit public, and not-for profit district ownership. The omitted category was private not-for profit hospitals. Teaching status was defined as hospitals with some residents. All payer DRG-based case mix index was included to account for differences in patients' severity. Median family income measured for the hospital's zip code area was included to capture demand effects and as a proxy for cross sectional wage variations. Analyses | We estimated regression models in which change in expenditures per adjusted discharge and excess mortality in 1989 were the dependent variables. Because all models were heteroskedastic, all reported tests of significance are based on White's robust standard errors . The Ramsey RESET test for specification errors was applied to all models to rule out the need for non-linear and interaction terms. The mortality models were weighted by the inverse of the standard error for the predicted mortality rate, to account for differences across hospitals in the accuracy of the excess mortality measures, which are due to differences in sample sizes . Since initial analyses indicated different associations (different betas) for for-profit and non-profit hospitals, we estimated fully interacted models, in which all variables were interacted with for-profit status. The hypotheses of significant marginal effect were therefore tested for the non-profit hospitals by a t test of the main effect and for the for-profit hospital by an F test of the linear restriction that the sum of the coefficients of the main and interaction effect are zero. Results : Description of sample hospitals | Table presents descriptive statistics for the hospitals included in the study. The majority of hospitals (52.6%) were private non-profit with the second largest group (26.0%) being for-profit institutions. Fifteen point four percent were teaching hospitals. The average hospital size did not change significantly over the 1982 --1989 period, remaining at 190 --200 beds. Occupancies declined significantly, from an average of 62.3% to 55.2%, and inpatient case mix increased significantly from 1.17 to 1.27, indicating that hospitals were treating sicker and more expensive patients at the end of the period. Both total expenditures and expenditures per adjusted discharge increased significantly. Table 1 | Descriptive Statistics The degree of competition among hospitals has not changed between 1982 and 1989. The HHI of around 0.3 suggests that competition was limited. (Markets with HHI values below 0.18 are considered moderately or very competitive ). The large variation in the HHI, however, indicates that many hospitals were located in competitive markets, with 25% of hospitals in markets with HHI below 0.17. Overall mortality rates averaged 10%. Average observed and predicted rates were very similar, but the variation in rates was higher for the observed rates compared with the predicted rates, suggesting substantial variations in excess mortality and quality across the sample. Resource allocation changes | Table reports the mean values for the dependent and independent variables included in the multivariate regressions. Table reports results by ownership -- for-profit and non-profit. These results are based on a fully interacted model estimated over pooled data by ownership. All models were highly significant (p < 0.01). The clinical services model explained 51% of the variation in expenditures per adjusted discharge, while the hotel and administrative services models explained 24% and 26% respectively. Table 2 | Means and standard deviations of variables included in the multivariate analyses Table 3 | Expenditures per adjusted Discharge -- Multivariate regression results Effect of competition | Table presents the marginal effect of competition, calculated from the regression results and using equations 2 and 3, for 1982 and 1989, as well as the change in these coefficients between the two years. (Note that the regression coefficients for the HHI variable were multiplied by -1 in table , such that a positive association means that expenditures per discharge increase with increased competition.) Table 5 | Marginal effect of competition on Expenditures per adjusted discharge (Positive values indicate increase with increased competition) Non-profit hospitals in more competitive areas had higher expenditures per adjusted discharge in all three categories in all years. The marginal effect was highest in clinical areas and lowest in administrative services. It declined significantly over time in both clinical and hotel services, but not in administrative services. The decline was almost three times as large in the clinical services compared with hotel services. By 1989, while the marginal effect of competition on expenditures in these services was still positive, it was no longer significantly different from zero. These findings are consistent with the hypothesis that the focus of competition on quality in 1982 has diminished significantly over the seven-year period we studied. The results for for-profit hospitals present a different picture. First, the association between expenditures per adjusted discharge and competition was statically significant only for administrative services. This association was also by far the strongest. It was negative, indicating that hospitals in more competitive markets spent less per discharge on administrative activities. The marginal effect was slightly smaller in 1989, suggesting that hospitals in more competitive areas may have reallocated resources into administrative services. They may have, for example, invested in better information and management systems that would allow them to better control costs. The association between competition and resource use was negative in clinical services and positive in hotel services. This is consistent with the hypothesis that for-profit hospitals compete on quality in those areas that can be easily observed by patients, namely hotel services, and cut back on resources in clinical services, where quality is more difficult for patients to evaluate directly. The change over the 1982 through 1989 period is also consistent with this hypothesis: the negative association between competition and clinical resources increased in 1989 as did the positive association between hotel resources and competition. The lack of significance of the associations may reflect the smaller number of for-profit hospitals in the sample and the resulting lower statistical power. (There were 83 for-profit hospitals and 13 independent variables, compared with 237 non-profit hospitals.) Other hospital and market characteristics | The strongest and most consistent relationship was between all payer case mix and expenditures per adjusted discharge in all categories (see table ). The association was substantially stronger for the clinical category and in non-profit compared with for-profit hospitals. Most other variables either exhibited no significant associations or no clear patterns. There were no significant differences in resource allocations by ownership. Teaching status was positively associated with clinical and hotel expenditures among the non-profit hospitals but exhibited a negative association among the for-profit hospitals. Percent bad debt and charity and percent occupancy had no significant relationship with expenditures among the non-profit but were associated with lower clinical and administrative expenditures among the for-profit hospitals. Median family income was associated with higher expenditure levels for all services among the non-profit hospital, but only with the clinical services among the for-profits. Risk adjusted excess mortality | Table reports the results of the regressions modeling the association between excess mortality (defined as the difference between observed and predicted mortality rate) and clinical expenditures per adjusted discharge, competition, ownership, and teaching status. The models explained between 1% and 5% of the variation in excess mortality. In all cases there was a negative association between clinical expenditure levels and excess mortality, implying that increased resources were associated with better mortality outcomes. This relationship was present for mortality from all causes as well as from the four specific causes, and was statistically significant at the 0.10 level or better. Table 4 | Risk adjusted excess mortality -- Multivariate Regression Results Table shows the increase in excess mortality that is associated with a decrease of 1 standard deviation (SD) in clinical expenditures per adjusted discharge, based on the estimated regression coefficients. For comparison, the table also provides the magnitude of 1 SD in excess mortality among the study hospitals. In all cases, the effect of a 1 SD in resources was less than a 1 SD in excess mortality. As expected due to the potential bias towards zero in the measures based on all causes, the associations were larger for the cause specific measures. Table 6 | Increase in excess mortality rates associated with 1 standard deviation decrease in clinical expenditures per adjusted discharge As discussed earlier, we hypothesized that competition may affect quality, including clinical quality, not only through its impact on resource use but also due to incentives to compete on quality. If indeed hospitals were competing on clinical quality, the association between the HHI and excess mortality, controlling for resource use, should have been positive and significant. In all cases, except for pneumonia, we did not find a significant relationship. In most cases there was also no significant relationship between ownership or teaching status and excess mortality. Discussion : In this paper we present a test of the hypothesis that changes in the nature of competition among California hospitals, resulting from selective contracting, were associated with changes in hospitals' resource allocation decisions. We find empirical evidence to suggest that resources have been shifted from clinical activities (which are not observed by patients) and into hotel services (which are more readily observable). These changes in resource allocation tended to be larger in hospitals located in more competitive areas. As the level of competition has not changed during the study period, the change in hospital behavior is likely to be a response to the change in the nature of competition. The relationship between resource allocation and competition differed by ownership. For-profit hospitals in more competitive areas had lower expenditures levels compared with those in less competitive areas. Among non-profit hospitals, we found the opposite -- clinical expenditures per adjusted discharge increased with competition. The trend over time, however, even though it was much stronger among the non-profit hospitals, was the same for both types. For both, the change in the marginal effect of competition (Deltabeta) was negative. As a result, the positive association between competition and clinical resource use among non-profit hospitals diminished and the negative association among the for-profit hospitals increased. The analyses of excess mortality demonstrate that clinical quality, at least as measured here, is positively associated with the amount of resources used in producing clinical services. Therefore, policies that create incentives for hospitals to limit resource use are likely to have an impact on health outcomes. Furthermore, as clinical quality is not easily observable by consumers, leading to disparity in incentives to provide hotel and clinical quality, more competitive areas are likely to experience a larger relative decline in resources allocated to clinical activities and hence worse mortality outcomes. The impact on health outcomes in non-profit hospitals may not be as large as it might have been because expenditure levels were curtailed not only in clinical areas, but in hotel services as well, although to a much lesser degree. This strategy spread the burden of cost containment efforts beyond clinical activities. If non-profit hospitals would have concentrated all their cost cutting efforts in clinical services, as did the for-profit hospitals, the impact on costs, and potentially on mortality outcomes, would have been 35% higher (see table ). The generalizability of the findings presented here is limited in several ways. First, quality was measured only in terms of excess mortality. While this is an important aspect of quality, it is likely to be an insensitive measure. Because measures based on mortality do not tend to be correlated with measures based on other outcomes , such as complications, one cannot deduce from this study that other aspects of clinical quality have been affected similarly by the changes in competition during the period. Furthermore, the mortality models we estimated, unlike the expenditures models, were cross sectional and are therefore subject to the usual concerns about potential bias due to omitted hospital specific effects. It should be noted, however, that the models did include the variables most likely to be associated with excess mortality -- patient level risks, expenditures, competition, ownership and teaching status. It should also be noted that while our findings with respect to changes in resource allocation are based on total expenditures, thus reflecting care for all patients, the mortality outcomes are based on the experience of Medicare patients only. Prior studies, however, suggest that patient care given by same provider does not vary by payer status . A more important generalizability question arises due to the sample selected for this study -- namely hospitals located only in California during the 1980s. Can the behavior of hospitals observed in this local and during this time period be assumed to generalize to other markets and other times? While the magnitude of the effects we measure in this study are clearly not generalizable, the directions of the effects are likely to transcend time and place, as they reflect basic behavioral responses to market incentives in accordance with theory. While this sample selection may be viewed as a limitation of this study, it is also its strength. By focusing on a period in which levels of competition were stable and where the change in the nature of competition can be traced to a specific legislative act, this study is able to test for the differential impact of price vs. quality competition, without confounding by other factors. Conclusion : In summary, the results of this study should be viewed as raising a cautionary question: are the hospital cost reductions that have been observed in California and nationally associated with increased mortality? Authors' Contributions : DM designed the study, performed the analyses, and wrote the manuscript. AB prepared the data set, and JZ participated in the design and analyses. Competing interests : None declared. Pre-publication history : The pre-publication history for this paper can be accessed here: Backmatter: PMID- 12079499 TI - Functional group interactions of a 5-HT3R antagonist AB - Abstract | Background | Lerisetron, a competitive serotonin type 3 receptor (5-HT3R) antagonist, contains five functional groups capable of interacting with amino acids in the 5-HT3R binding site. Site directed mutagenesis studies of the 5-HT3AR have revealed several amino acids that are thought to form part of the binding domain of this receptor. The specific functional groups on the ligand that interact with these amino acids are, however, unknown. Using synthetic analogs of lerisetron as molecular probes in combination with site directed mutagenesis, we have identified some of these interactions and have proposed a model of the lerisetron binding site. Results | Two analogs of lerisetron were synthesized to probe 5-HT3R functional group interactions with this compound. Analog 1 lacks the N1 benzyl group of lerisetron and analog 2 contains oxygen in place of the distal piperazine nitrogen. Both analogs show significantly decreased binding affinity to wildtype 5-HT3ASRs. Mutations at W89, R91, Y142 and Y152 produced significant decreases in binding compared to wildtype receptors. Binding affinities of analogs 1 and 2 were altered only by mutations at W89, and Y152. Conclusions | Based on the data obtained for lerisetron and analogs 1 and 2, we have proposed a tentative model of the lerisetron binding pocket of the 5-HT3ASR. According to this model, The N-benzyl group interacts in a weak interaction with R91 while the benzimidazole group interacts with W89. Our data support an interaction of the distal amino nitrogen with Y142 and Y152. Keywords: Background : The cysteine-loop family of ligand gated ion channels (LGIC) is comprised of receptors with pentameric quaternary structure and at least two ligand binding sites present at the subunit interfaces . This receptor family is characterized by the presence of a critical disulfide loop structure within the binding site and an integral ion selective channel. LGIC receptors are found in both the peripheral and central nervous systems. Members of this family include the acetylcholine receptors , the gamma-amino butyric acid type A receptor (GABAAR) , and the glycine receptor (GlyR) . The first subunit of the 5-HT3R was cloned in 1991 . The sequence of this subunit was shown to be highly homologous to LGIC receptors and thus identified the 5-HT3R receptor as another member of this superfamily . Similar to other LGIC receptors, more than one subtype has been identified. Two splice variants of an A subunit (long and short forms), and a single B subunit have been cloned . Both the long and short forms of the A subunit are capable of forming functional homomeric receptors [5-HT3ALR and 5-HT3ASR] although some differences between an agonist and partial agonist activity have been observed . A third subtype is formed by a combination of the A and B subunits to produce a heteromeric receptor of unknown stoichiometry . Heteromeric receptors are pharmacologically and functionally distinct from the homomeric 5-HT3AL and 5-HT3AS receptors . 5-HT3Rs are distributed throughout the central and peripheral nervous system, playing a significant role in phenomenon such as anxiety, emesis and alcoholism. Antagonists to 5-HT3Rs are clinically efficacious in the treatment of chemotherapy-induced emesis and recent studies on human subjects have suggested their potential application in the treatment of early onset alcoholism . Hibert et al proposed an early model for the antagonist pharmacophore of the 5-HT3R . According to this model, all 5-HT3R antagonists contain an aromatic ring, a carbonyl oxygen or bioisosteric equivalent, and a basic nitrogen. According to Hibert's model, the basic nitrogen is located 5.2A from the centre of the aromatic ring and approximately 1.7A above plane of the ring. The carbonyl oxygen and the aromatic ring are coplanar and separated by a distance of 3.3A. Recent studies have expanded on this model to include another lipophilic region and a second hydrogen bonding interaction two atoms away from the first . A compound that contains all five pharmacophoric regions was synthesized by Orjales et al. This compound (1-(phenylmethyl)-2-piperizinyl benzimidazole or lerisetron) is shown in figure and is a potent 5-HT3R antagonist. Functional groups on this compound capable of forming interactions with the receptor are the distal amino group, a benzimidazole and a benzyl group in the N1 position of the benzimidazole. While Lerisetron contains no carbonyl group, the second nitrogen contained in the benzimidazole heterocycle could act as bioisostere of this functional group . Orjales demonstrated the importance of the N-benzyl group by synthesizing several N1 substituted analogs of Lerisetron. Removal of the N-benzyl group produced a 80-fold decrease in affinity, indicating a role for this group in interacting with the 5-HT3R. Other studies have supported this observation and suggest a more specific electrostatic interaction . Figure 1 | 5-HT3R antagonists. 5-HT3R antagonists. Granisetron and Lerisetron are shown along with the two analogs utilized to probe the functional group interactions of binding site amino acids. Analog 1 lacks the N-benzyl functional group. Analog 2 contains oxygen in place of the distal piperazine nitrogen. While structure-activity relationship studies and molecular modeling have led to the development of a detailed pharmacophore model, determining specific point interactions between 5-HT3 antagonists and binding site amino acids has proven difficult. Mutagenesis studies have identified the interaction of amino acids W89 and R91 in the binding of 5-HT3R ligands . Studies conducted in our laboratory have identified three additional putative binding site residues (Y140, Y142, and Y152) . W89 and R91 are present in a conserved region of LGIC receptors often referred to as loop D . Similarly, Y140, Y142 and Y152 are located in the region homologus to E loop region of nicotinic AchR. In this study, we have endeavoured to identify the amino acids interacting with the different functional groups present on the lerisetron molecule in order to develop a model for interaction of this compound with the 5-HT3R. Using site directed mutagenesis in combination with analogs of lerisetron, we have identified amino acids that appear to interact selectively with the terminal amino group, the N-benzyl group and the aromatic benzimidazole. Results : Functional activity of lerisetron | Whole cell patch-clamp experiments were performed to test the functional activity of lerisetron. No response was observed when lerisetron was applied alone (data not shown). When co-applied with 5-HT, lerisetron inhibited the absolute magnitude of the response with no apparent alteration of the response profile . The combination of several identical inhibition experiments produced a Ki value of 0.2 +- 0.03 nM for lerisetron inhibition of the 5-HT induced response. These data correspond well with previously reported data for this compound and verify the competitive antagonist action of lerisetron. Analogs of lerisetron have been shown to inhibit 5-HT3Rs in a similar manner . Figure 2 | Inhibition of 5-HT induced responses by Lerisetron. Inhibition of 5-HT induced responses by Lerisetron. tsA 201 cells transfected with 5-HT3ASR cDNA were clamped at a holding potential of -60 mV and perfused with 4 muM 5-HT (lower trace) or 4 muM 5-HT and 0.3 nM lerisetron (upper trace). Lerisetron reduced the peak 5-HT induced currents from 2.0 nA to 1.0 nA with no change in the response characteristics. An IC50 value was determined by a combination of similar experiments and determined to be 0.4 +- 0.03 nM. Importance of the N-benzyl and distal piperazine nitrogen to binding of lerisetron | The Ki value for lerisetron inhibition of [3H]-granisetron binding to wildtype receptors was determined to be 0.8 +- 0.19 nM (Figure and Table ). This value agrees with previously published data for this compound. The Ki values for analogs 1 and 2 under identical conditions are 25 +- 3.2 nM and 320 +- 82 nM respectively (Figure , Table ). The observed change in Ki represents the decreases in binding energy resulting from removal of the N-benzyl group (analog 1) and the distal piperazine nitrogen (analog 2). Figure 3 | Inhibition of [3H]-granisetron binding to mutant and wildtype receptors by lerisetron. Inhibition of [3H]-granisetron binding to mutant and wildtype receptors by lerisetron. Competition binding assays were performed as described in Materials and Methods. Each point represents a mean +- SE of n>4 experiments. Ki values calculated from this data and the relative magnitude of the shift in Ki compared to wildtype receptors are shown in Table . Y140A produced no significant change in Ki values. W89F, W89Y and R91A mutations produced moderate increases in Ki. Y142A and Y152A mutations resulted in increases in Ki of 160 and 190 fold respectively. Figure 4 | Inhibition of [3H]-granisetron binding to wildtype and mutant receptors by analog 1 and analog 2. Inhibition of [3H]-granisetron binding to wildtype and mutant receptors by analog 1 and analog 2. Competition binding assays were performed as described in Materials and Methods. Each point represents a mean +- SE of n> 4 experiments. IC50 values were determined from the data and a Ki value calculated using the Cheng-Prusoff equation. Ki values for inhibition on each mutant are shown in Table for all three compounds. A. Wildtype B. W89F C. W89Y D. R91A E. Y142A F. Y152A Table 1 | Summary of inhibition data obtained for lerisetron, analog 1 and analog 2 on mutant and wildtype receptors. Ki values were calculated from IC50 values as previously described. All data is the result of n > 4 experiments and is expressed as the mean +- SE. The relative change in Ki was calculated as the Ki (mutant) / Ki (wildtype) and indicates the increase in Ki relative to wildtype +- SE. * indicates significant difference in fold change value. Kd values for [3H]granisetron binding to wt and mutant receptors were reproduced from reference 25. Identification of amino acids interacting with Lerisetron | In order to determine the nature of the amino acids interacting with the distal amino and N-benzyl groups of lerisetron, we constructed 5-HT3ASRs containing mutations at W89, R91, Y140, Y142 and Y152. Figure shows inhibition of [3H]-granisetron binding by lerisetron on wildtype and mutant receptors. For most amino acids, an alanine substitution was constructed in order to effectively remove any amino acid interaction with the ligand. For W89, an alanine substitution has been shown to prevent binding of [3H]granisetron; therefore a less severe mutation was constructed. The W89F mutation produces a 18-fold change in Kd for [3H]-granisetron binding (18 +- 2 nM) and the W89Y mutation produces a 5.8-fold change in Kd (5.7 +- 0.7 nM). Mutation of amino acid R91 to alanine produced a 5-fold change in Kd for [3H]granisetron binding (4.9 +- 0.7 nM) . These data agree well with previously reported values . Alanine mutations at the tyrosine positions Y140, Y142 and Y152 also produced minor increases in Kd for [3H]granisetron binding (2.7 +- 0.19 nM, 4.5 +- 0.5 nM and 7.8 +- 1.1 nM respectively) . Only small changes in Ki for lerisetron were observed for the Y140A mutation while the Y142A and Y152A mutations produced large increases in the Ki (Table and Figure ). For W89F and W89Y, the changes in Ki observed for lerisetron were much smaller than for the alanine mutations at Y142A and Y152A, as would be expected for the less severe nature of these mutations. The changes were, however significant (p < 0.001 in both cases) and are similar to the changes in Kd reported for [3H]granisetron. The increase in Ki on the W89F mutant receptor was 4.8 +- 0.56 fold and the increase in Ki on the W89Y receptor was 3.6 +- 0.4 fold. The R91A mutant produced an increase in Ki of 7.6 +- 1.5 fold as compared to the wildtype receptor. These data indicated potential interactions of lerisetron with W89, R91, Y142 and Y152. Mutation of W89 | As mentioned above, the lack of [3H]-granisetron binding to W89A mutant receptors necessitated the use of W89F and W89Y mutations to analyze functional group interactions. The effects of these mutations on the Ki for analogs 1 and 2 are shown in figure , and Table . Analog 1 inhibited [3H]-granisetron binding to W89F receptors with a Ki of 170 +- 54 nM (7 +- 3.2 fold increase, p < 0.001) and W89Y receptors with a Ki of 81 +- 14 nM (3.2 +- 0.6 fold increase, p < 0.001). This reflects a significant increase in Ki and reflects a potential interaction of analog 1 with W89. The strength of this interaction is apparently similar to the strength of the interaction with [3H]-granisetron and lerisetron since the magnitude of the change is similar in both cases. Analog 2 also showed a significant increase in Ki as a result of the W89F and W89Y mutations. The magnitude of the change for W89F (5.1 +- 1.3 fold, p < 0.05) was similar to that observed for lerisetron and analog 1. The W89Y mutation produced a 6.8 +- 1.6 fold change in Ki (p < 0.05). Thus, all three compounds appear to form similar interactions with W89. Mutation of R91 | Mutation of R91 to alanine (R91A) resulted in a significant, but small increase in Ki for lerisetron of 7.6 +- 1.5 fold (p < 0.01). Figure shows the inhibition of [3H]-granisetron binding by analogs 1 and 2 at R91A mutant receptors. No significant change in Ki was observed on these receptors for either analog 1 (0.9 +- 0.28 fold) or analog 2 (0.56 +- 0.14 fold) as compared to the wildtype receptor. Mutation of Y142 | Mutation of Y142 to alanine produced one of the largest observed changes in Ki for lerisetron (Figure and Table ). The Ki obtained for lerisetron was 130 +- 28 nM, reflecting a change of 160 +- 37 fold compared to wildtype receptors. The Ki value for analog 1, in contrast, increased only 6.8 +- 2.3 fold (p < 0.01) as a result of this mutation (Figure and Table ). The Ki for analog 2 showed a similar change of 17 +- 0.77 fold (p < 0.01). While these Ki values are significantly different from wildtype values for each analog, the lack of larger effects suggests that neither analog 1 nor analog 2 bind as strongly as lerisetron to Y142. Mutation of Y152 | The Y152A mutation showed the most variability in its effects on Ki values for lerisetron, analog 1 and analog 2 (Figure , Figure and Table ). Lerisetron inhibited [3H]-granisetron binding with a Ki value of 150 +- 36; an increase of 190 +- 43 fold compared to wildtype values. The Ki value for analog 1 increased from 25 +- 3.2 nM (wildtype) to 2.5 +- 0.40 muM. This change of 100 +- 16 fold is slightly smaller, but not significantly different from the relative change observed for lerisetron. The Ki for analog 2 increased from 0.32 +- 0.08 muM on wildtype to 13 +- 4.2 muM on Y152A mutant receptors (40 +- 12 fold increase). The increase observed for analog 2 was significantly less than that observed for both lerisetron and analog 1. The smaller change in Ki for analog 2 suggests that analog 2 binds weakly to Y152 while lerisetron and analog 1 bind more tightly. Discussion : The purpose of this study was to ascertain the functional group interactions of lerisetron with specific amino acids present in the 5-HT3R binding site. To this end, we examined the effects of specific amino acid mutations on the binding of lerisetron and two analogs. These analogs, shown in Figure , are identical to lerisetron in structure; however, each analog lacks a single functional group found in lerisetron. By comparing the effects of a specific amino acid mutation on the Ki for inhibition of [3H]-granisetron binding, we can begin to identify the functional groups likely to participate in that interaction. Five different amino acids were tested: W89, R91, Y140, Y142 and Y152. Each of these amino acids has been shown in previous studies to alter the binding of 5-HT3R ligands . A summary of the changes in Ki is presented as a bar chart in Figure and . Figure 5 | Relative increases in Ki for lerisetron, analog 1 and analog 2 on mutant and wildtype receptors. Relative increases in Ki for lerisetron, analog 1 and analog 2 on mutant and wildtype receptors. The relative change in Ki was determined as Ki (mutant)/ Ki (wildtype) for each compound. A. W89Y, W89F, R91A B. Y140A, Y142A, Y152A. Lerisetron showed a significant increase in Ki for all mutants except Y140A. Increases in Ki were observed for analog 1 and 2 on W89 and Y152A. While lerisetron binds to wildtype receptors with high affinity, analog 1 binds with lower affinity (31 fold increase in Ki compared to lerisetron). Analog 2, which lacks the terminal nitrogen of lerisetron, binds with even lower affinity (a 400-fold fold increase in Ki compared to lerisetron -- Table ). These data demonstrate the relative importance of the N-benzyl and the terminal nitrogen moieties for lerisetron binding. Cation-pi interactions involving aromatic residues and a quaternary ammonium have been demonstrated to play a major role in binding of nicotinic ligands to nAchRs . Our data support a similar role for Y142 and Y152 in binding of lerisetron to the 5-HT3A receptor. Functional group interactions of W89 | The W89F mutation produced a significant increase in Ki for all three compounds. The magnitude of the change was similar in all cases. In addition, the increase in Ki was identical to the increase in Kd that has been observed for [3H]granisetron binding on this mutant . Alterations in Ki resulting from the W89Y mutation were slightly less, however the change was again the same for lerisetron, analog 1 and analog 2. These data suggest that all three compounds form binding site interactions with W89. The interaction between lerisetron and W89 is unlikely to be via the N-benzyl functional group since the Ki for analog 1 was also altered by this mutation. The same argument can be made for the distal piperazine nitrogen since the Ki for analog 2 also increased. The portion of the molecule common to all three compounds, the aromatic benzimidazole, is thus the most likely point of interaction for W89. Functional group interactions of R91 | The R91A mutation increased the Ki value for lerisetron inhibition of [3H]granisetron binding by 7.6 fold. This is a moderately small change for an alanine mutation, particularly considering that the smallest change in Ki for removal of a functional group on lerisetron (the N-benzyl group) was 31 fold. It is therefore likely that this interaction is either extremely weak or the change in Ki is the result of a structural change in the binding site. Previous studies concluded that R91 was an important interaction for the 5-HT3R agonist 5-hydroxytryptamine (5-HT), since the Ki for 5-HT inhibition increased over 3000 fold as a result of the R91A mutation . A change in Kd for [3H]granisetron binding to R91A was also observed. In order to determine whether the N-benzyl or distal piperazine nitrogen of lerisetron was involved in an interaction with R91, we tested both analog 1 and 2 on R91A mutant receptors. No change in Ki was observed for either compound. This result makes it much more difficult to assign the correct functional group to this amino acid since it suggests that one or both of the compounds is no longer binding the receptor in precisely the same manner as lerisetron. Considering the small change observed for lerisetron binding as a result of this mutation, even a slight reorientation of the molecule in the binding site could result in the loss of this interaction. Functional group interactions of Y142 | The Ki values for inhibition of [3H]granisetron binding by analogs 1 and 2 were altered only slightly by the Y142A mutation. The magnitude of the increase in Ki for lerisetron, however, was considerably larger (160 fold) and is indicative of an important interaction of the compound with Y142. The lack of a large change in Ki for both analogs makes it difficult to interpret this data since one or both of the compounds appears to be interacting differently with the binding site than lerisetron. Analogs 1 and 2 differ from each other both in the functional groups contained in the molecule and their structural similarity to lerisetron. Analog 2 is most similar in overall structure. The substitution of oxygen for the distal amino nitrogen alters the potential interactions formed at this position, but is likely to have a small effect on the overall size and shape of the molecule. Analog 1 is far less similar to lerisetron and more similar to the 5-HT3R antagonist granisetron. Previous studies have shown that the binding of granisetron is not affected by the Y142A mutation . Analog 1 may bind more similar to granisetron than lerisetron and thus would be unaffected by mutations at Y142. This is less likely to be the case with analog 2. The strength of the putative interaction at Y142 can be identified by examining the change in binding of lerisetron as a result of the Y142A mutation. The Y142A mutation produced a 160 fold change in Ki. This change reflects the binding energy lost as a result of the alanine substitution. The observed change in Ki on wt receptors is much larger than that observed for removal of the N-benzyl group (31 fold), but is similar to that observed for substitution of the distal amino nitrogen in analog 2 (400 fold). Taken together with the close structural similarity of analog 2 to lerisetron, it can be concluded that comparison of analog 2 and lerisetron should provide the best means of identifying the interaction at Y142. No change in Ki was observed for analog 2 as a result of the Y142A mutation indicating a lack of any significant interaction of this compound with Y142. These data support our hypothesis that Y142 interacts with the distal piperazine nitrogen of lerisetron. A second amino acid may also be involved since the change in Ki for lerisetron binding as a result of the Y142A mutation was smaller than the change produced by substitution of the piperazine nitrogen. As described below, one candidate for this second amino acid is Y152. Functional group interactions of Y152 | The Y152A mutation produced increases in Ki for all three compounds although the magnitude of the change differed. The increases in the Ki values were 190 fold for lerisetron, 98 fold for analog 1 and only 40 fold for analog 2. Thus, analog 1 retains much of its ability to interact with Y152 despite the absence of the N-benzyl group, while analog 2 interacts more weakly with this amino acid. Since the Ki for analog 1 is increased by the Y152A mutation, it is unlikely that the N-benzyl group interacts with Y152. The small change in Ki for analog 2 supports a partial interaction of Y152 with the distal piperazine nitrogen although some interaction with another group is also apparent. This other group would be expected to be in close proximity to the distal nitrogen. The most likely candidate is the other nitrogen of the piperazine ring. Thus Y152A may form a partial interaction with both piperazine nitrogens. Conclusions : Figure shows a hypothetical model of the lerisetron-binding site supported by our observations. The model illustrates the secondary structure of the region of the receptor from Y140 -- Y152 in a loop configuration. This structure is supported by site-directed mutagenesis data as well as structural predictions obtained from other LGIC receptors . The recent determination of the structure of a nicotinic acetylcholine binding protein that shares significant homology with the LGIC family also supports a loop structure in this part of the protein. The region from W89 through Y93 is shown as a beta-sheet as has been hypothesized based on site-directed mutagenesis studies of this strand of the 5-HT3R . Our data indicate the functional groups of lerisetron that may interact with W89, R91, Y142 and Y152. Figure 6 | Model of the 5-HT3R binding site. Model of the 5-HT3R binding site. The model illustrates the major points discussed in the text. Lerisetron is shown spanning the region between the D and E loops of the receptor. Both loops are illustrated as beta-sheets as described. The side chains are presumed to point in or out of the page depending on their position. W89, R91, Y140, Y142 and Y152 all presumably extend into the binding site. The terminal piperazine nitrogen is shown interacting primarily with Y142, but is also capable of forming an interaction with Y152. Y152 may also form an interaction with the second piperazine nitrogen. W89 is illustrated as forming an aromatic interaction with the benzimidazole. While R91 is shown in close contact to the N-benzyl group, the data support only a weak interaction at this point. W89 is shown interacting with the aromatic benzimidazole group of lerisetron although the precise position of W89 relative to this group is not known. The W89 interaction with this group is supported by the observed increase in Ki for lerisetron, analog 1 and analog 2. Since the benzimidazole group is common to all three compounds it is the most likely point of interaction. W89 also represents a common interaction in the binding site for both lerisetron and [3H]granisetron. Y142 is shown interacting with the distal piperazine nitrogen possibly through a cation-pi interaction. This orientation of an amino group interacting with an aromatic amino acid in a cation-pi interaction has been shown for the nicotinic acetylcholine receptor and has been hypothesized for many LGIC receptors [-,]. This conclusion is based on both the magnitude of the change observed on the wild type receptor for removal of the amino group (400 fold) compared to the effect of the Y142A mutation on lerisetron binding (160 fold) and the lack of any major change in Ki for analog 2 as a result of this mutation. Our data does not support an interaction of this amino acid with either the N-benzyl or benzimidazole portions of lerisetron. Y152 is shown positioned between the two piperazine nitrogens. This conclusion is supported by the smaller increase in Ki for analog 2 (40 fold) compared to that observed for lerisetron (190 fold). These results suggest a partial interaction of Y152 with the distal piperazine nitrogen. Since some change was observed, a second interaction is also likely. The functional group in closest proximity to the distal piperazine nitrogen is the other nitrogen on the piperazine ring. Another possibility would be the N-benzyl interaction, however, since the Y152A mutation also produced a large increase in Ki for analog 2, this conclusion is not supported by our data. R91 is shown as interacting with the N-benzyl group. This is a difficult conclusion to make considering the small effect of the R91A mutation on lerisetron binding. The interaction is included in the model based on structural information obtained from the crystal structure of AChBP . The region of this protein homologous to loop E and loop D of the 5-HT3A receptor suggests a loop structure from Y140 to Y152 and a 3-residue turn containing a glycine at position 147 and the beta-strand from W89 through Y93 oriented as shown in Figure . The orientation of lerisetron between W89 and Y142A as shown would enable the N-benzyl group to be positioned in close proximity to R91. If this is the case, then a small alteration in position of analog 1 or 2 in the binding site could result in the loss of this presumably weak interaction. The apparent alterations in the binding site location of analog 1 would be consistent with this hypothesis. An alternate hypothesis would place the N-benzyl group in a different position, interacting with another amino acid; either solely or in concert with R91. Our data support a binding site for lerisetron on the 5-HT3R that spans the D and E loop regions. Table shows the sequence alignment for the 5-HT3R, the alpha7 receptor and the AChBP for these loops. Sequence alignment of mouse 5-HT3 AR, alpha7 nAchR and AChBP result in alignment of the proposed D and E loop of the 5-HT3 AR with corresponding regions of the alpha7 nAchR and AChBP. The amino acids W89, R91 Y140, Y142 and Y152 of the 5HT3 A R can be aligned with W53, Q55, L102, R104, and M114 of the AChBP . These amino acids form a cluster in the proposed acetylcholine binding domain of AChBP similar to that proposed in our model. Both loops have been identified on the complementary face of the binding site of the nAChR. It is unknown if lerisetron utilizes amino acids on the principal face although none have been identified. The model for lerisetron binding will be further refined as its interactions with other binding site amino acids are investigated . Of particular interest would be potential interactions of the N-benzyl group that would account for the decrease in binding affinity of analog 2. Additional information gained from comparison of our model with the recent crystal structure of the AChBP demonstrates that lerisetron can be roughly 'fit' into the binding site such that all the residues line up as shown in our model. While this is not direct evidence that the model is correct, subsequent molecular modeling of the data presented in this paper may provide further support for our hypothesis. Our current model provides an initial working hypothesis that can form the basis of further investigation. Also, while it is unclear whether the information obtained in this study can be extended to other 5-HT3R ligands, a similar approach would be useful in identifying functional group interactions for mCPBG, 5-HT, dtC and granisetron. Table 2 | Sequence alignment of the mouse 5-HT3R with the mouse nicotinic alpha7 receptor and the AChBP. Two sequences are shown. The top sequence is the putative D loop containing W89 and R91 (homologous to W53 and Q55 of the AChBP). The lower sequence shows the putative E loop and contains Y140, Y142 and Y152 (homologous to L102, R104 and M114 of the AChBP). Materials and Methods : Mutagenesis | Wild type 5-HT3AS mouse receptor cDNA was derived from N1E-115 neuroblastoma cells as previously described . Mutant receptors were constructed using polymerase chain reaction (Quick change mutagenesis kit, Promega). All mutations were confirmed by DNA sequencing. Cell culture methods and transfections | tsA201 cells (a derivative of the HEK293 cell line) were grown in Dulbecco's modified Eagles medium (D-MEM) containing 10% FBS and 100-units/ml penicillin/streptomycin. Cultures were maintained in humidified atmosphere of 5% CO2 at 37C. For binding studies, tsA201 cells were plated at a density of 5 x 106 cells/75 cm2 and grown for 9 hours prior to transfection. Cells were transfected with 10 mug murine 5-HT3ASR cDNA using calcium phosphate co-precipitation (New Life Technologies, NY), then incubated 36 hours prior to harvesting. For whole cell patch clamp experiments, tsA201 cells were plated at a density of 0.25 x 106 cells/27 cm2 dish and grown 12 hours prior to transfection. Cells were washed with fresh culture medium then transfected with 10 mug 5-HT3ASR cDNA using Qiagen Superfect transfection reagent (Qiagen, CA). Transfected cells were incubated with this mixture for 2.5 hours, then divided into 35 mm culture dishes at a density of approximately 5 x 104 cells/dish and incubated for 24 hours at 37C before recording. Radioligand Binding Assay | Transfected cells were scraped from the dishes, washed twice with Dulbecco's PBS (New Life Technologies, NY), then resuspended in 1.0 ml PBS/100 mm dish. Cells were either used fresh or frozen at this step until needed. Immediately prior to use, cells were homogenized in PBS using a glass tissue homogenizer then centrifuged at 35 000 x g for 30 minutes in a Beckman JA20 rotor. Membranes were washed once more with PBS then resuspended in 1 ml PBS/100 mm dish. Protein content was determined using a Lowry assay (Sigma. Diagnostics, St. Louis, MO). Binding assays were performed in PBS. For Kd determinations, 100 mul of homogenate was incubated at 37C for 1 hour with varying concentrations of [3H] granisetron (NEN, MA). Specific binding of [3H] granisetron was determined as the bound [3H] granisetron not displaced by a saturating concentration of a competing ligand (100 muM mCPBG or 10 muM MDL-72222). Kd values were determined by fitting the binding data to the following equation using GraphPad PRISM (San Diego CA): B = Bmax [L] n / ([L] n + Kn), where theta is bound ligand, Bmax is the maximum binding at equilibrium L is the free ligand concentration and n is the Hill coefficient. For Ki determinations, 100 mul of homogenate was incubated at 37C for 2 hours with varying concentrations of inhibitor and [3H] granisetron (NEN, MA). Binding was terminated by rapid filtration onto a GF/B filters. The IC50 values were calculated by fitting the data to the following equation using GraphPad PRISM (San Diego CA): theta = 1/ (1+(L/IC50)), where theta is the fractional amount of [3H] granisetron bound in the presence of inhibitor at concentration L as compared to the amount of [3H] granisetron bound in the absence of inhibitor. IC50 is the concentration at which theta = 0.5. The Ki is calculated from the IC50 value using the Cheng-Prusoff equation. Electrophysiological Methods | Transfected tsA201 cells were transferred to a recording chamber and submerged in extracellular recording buffer containing 25 mM HEPES pH 7.4, 140 mM NaCl, 1.7 mM MgCl2, 5 mM KCl, 1.8 mM CaCl2. Patch electrodes (2 --2.5 MOmega) were filled with intracellular recording buffer containing 25 mM HEPES pH 7.4, 145 mM KCL, 2 mM MgCl2 and 1 mM EGTA. Cells were clamped in whole cell configuration at a holding potential of -60 mV. Currents elicited by agonist application were measured using an Axopatch 200B amplifier (Foster City, CA) under computer control (DataPac 2000, RUN Technologies). Agonists and antagonists were dissolved in extracellular solution and delivered to cells using a rapid perfusion system (Warner Instruments, Hamden, CT). For EC50 determinations, responses were normalized to the maximum response obtained from the full agonist 5-HT and fitted to the equation Psi= 1/1+(EC50/ [C] n), where Psi is the normalized current at 5-HT concentration [C], EC50 is the concentration of 5-HT needed to obtain half maximal activation and n is the apparent Hill coefficient. For inhibition experiments, cells were exposed to inhibitor alone for 30 s prior to co-exposure with 5-HT. Inhibited responses were calculated as a fraction of the response to 5-HT alone. Data were plotted as the fractional response versus the concentration of inhibitor and analysed using GraphPad software. The IC50 value was calculated as the concentration of antagonist inhibiting the 5-HT evoked response by 50%. A Ki value was calculated from the IC50 using the Cheng-Prusoff equation. Synthesis of Lerisetron and its analogs | All target molecules were prepared according to a general 2-step synthesis reported previously by Orjales et al. with only slight modification . Commercially available 2-chlorobenzimidazole, in dry DMF was treated with a slight excess of NaH, (1.1eq). After stirring for 1 hour at room temperature, one equivalent of the appropriate alkyl bromide was added slowly and the reaction mixture heated under reflux for > 5 hours (the reaction was monitored by TLC). Reaction product was partitioned between water and methylene chloride; organic layer was dried (Na2SO4) and concentrated in vacuum. The solid residue was purified by Flash chromatography, which afforded the corresponding N-substituted 2-Chlorobenzimidazole intermediates in good yield. The final step involved a nucleophilic substitution of the 2-chloro group by piperazine at high temperatures. The reaction was performed neat using 4 --10 fold excess piperazine and typically heated for a short period only, (30 --45 min). Similar work-up afforded a residue that was purified by either crystallization or chromatography. The yields ranged from 40 --95%. All compounds were characterized by NMR, MS, HRMS, and /or elemental analysis or were identical to literature reports. Materials | D-MEM, Penicillin-Streptomycin, fetal bovine serum, and Trypsin were obtained from New Life Technologies. 5-HT and MDL-72222 were obtained from RBI. [3H]-granisetron (84 Ci/mmol) was purchased from New England Nuclear. Backmatter: PMID- 12079498 TI - Low solubility of unconjugated bilirubin in dimethylsulfoxide -- water systems: implications for pKa determinations AB - Abstract | Background | Aqueous pKa values of unconjugated bilirubin are important determinants of its solubility and transport. Published pKa data on an analog, mesobilirubin-XIIIalpha, studied by 13C-NMR in buffered solutions containing 27 and 64 vol% (C2H3)2SO because of low aqueous solubility of mesobilirubin, were extrapolated to obtain pKa values in water of 4.2 and 4.9. Previous chloroform-water partition data on bilirubin diacid led to higher estimates of its pKa, 8.12 and 8.44, and its aqueous solubility. A thermodynamic analysis, using this solubility and a published solubility in DMSO, suggested that the systems used to measure 13C-NMR shifts were highly supersaturated. This expectation was assessed by measuring the residual concentrations of bilirubin in the supernatants of comparable DMSO-buffer systems, after mild centrifugation to remove microprecipitates. Results | Extensive sedimentation was observed from numerous systems, many of which appeared optically clear. The very low supernatant concentrations at the lowest pH values (4.1-5.9) were compatible with the above thermodynamic analysis. Extensive sedimentation and low supernatant concentrations occurred also at pH as high as 7.2. Conclusions | The present study strongly supports the validity of the aqueous solubility of bilirubin diacid derived from partition data, and, therefore, the corresponding high pKa values. Many of the mesobilirubin systems in the 13C-NMR studies were probably supersaturated, contained microsuspensions, and were not true solutions. This, and previously documented errors in pH determinations that caused serious errors in pKa values of the many soluble reference acids and mesobilirubin, raise doubts regarding the low pKa estimates for mesobilirubin from the 13C-NMR studies. Keywords: Background : The saturation status of unconjugated bilirubin (UCB) is relevant to understanding the pathophysiology of jaundice and to interpreting experiments with UCB . UCB, in its diacid form (H2B), has a low solubility (So) of 51 nM in water . The total solubility (S) at any pH is determined by So, pKa values, and pH : S = [H2B] + [HB-] + [B=] = So(1 + Ka1/ [H+] + Ka1Ka2/ [H+]2) (Eq. 1) Self-association of UCB dianion, B=, can also increase S . Beginning in 1995, a series of papers reported the use of 13C-NMR to study the ionization of a close analogue of bilirubin-IXalpha, mesobilirubin-XIIIalpha (MBR), along with several soluble reference acids, in buffered mixtures of (C2H3)2SO and water . Due to the very low aqueous solubility of MBR, data were obtained only at two high concentrations of (C2H3)2SO (64 and 27 vol%). Its pKa values in "water" (actually in 1 vol% of ((C2H3)2SO), obtained by an extrapolation procedure based on the behavior of soluble reference acids, were 4.2 and 4.9, far lower than values of 8.12 and 8.44 obtained by solvent partition between chloroform and buffered aqueous solutions . These serious discrepancies led us to reexamine several experimental aspects of the 13C-NMR studies and the implications of their purported low pKa values for the solubility of UCB. Inaccuracies in the measurements of buffer pH and of the pKa values of the reference 13C-carboxylic acids, related to failure to correct for the strong effects of DMSO on the pKa values of weak acids, have been previously noted and acknowledged . In addition, as discussed later, a thermodynamic theory about solubility in mixed solvents, using the So values of 51 nM in water and 10 mM in pure DMSO , suggested that So of UCB would be only about 0.15 muM in 27 vol% DMSO and 2.2 muM in 64 vol% DMSO, which are well below concentrations used in the MBR studies. This implies serious supersaturation effects. In fact, turbidity was reported for some of the systems used in the 13C-NMR papers , indicating the formation of coarse suspensions. By definition, as stressed in the Conclusions section, pKa determinations are valid only for monomeric species and require that solutions are below saturation at all pH values studied. Even reversible aggregation of monomers in undersaturated solutions is known to affect pKa estimates . If supersaturation leads to the formation of fine sols or coarse suspensions, the data are unacceptable for determination of the pKa values of monomers. In the present paper, we assess whether some of the systems used in the 13C-NMR studies were supersaturated with MBR. Our experimental work on sedimentation was done with unconjugated bilirubin (UCB) and we used DMSO instead of its deuterated analogue, (C2H3)2SO. It is known that, when alkaline aqueous UCB is acidified to neutral or low pH's, "Usually a colloid suspension of bilirubin is formed and the solution remains clear, as observed by the naked eye, thus inviting an erroneous interpretation" . Such systems, which simulate true solutions, often show sedimentation on centrifugation . We here report that sedimentation of UCB from apparently clear solutions can likewise be extensive when UCB in DMSO is diluted with aqueous buffers to final mole fractions (N) of DMSO = 0.025, 0.086 and 0.31, corresponding to 9, 27, and 64 vol% of DMSO. A thermodynamic theory is used to examine the effect of added DMSO on So. Our findings, consistent with our partition-derived So, S and pKa values of UCB in aqueous buffers , indicate that the recently reported low pKa values of MBR in comparable (C2H3)2SO -water systems , were determined above saturation. Results : Residual UCB in the supernatants after centrifugation | Many systems initially appeared optically clear, but well over 90% of initial UCB sedimented on centrifugation of most samples below pH 7.2. Overall recoveries (UCB in su